Microarray Probes on PGSC0003DMT400042642

Probe IDChipProbe Sequence
CUST_31515_PI426222305 JHI_St_60k_v1 CAGCCATTATAGGTGTTGAGATAGCCTTCTTGATCTCTTCAATTAGACATACGTCCGCCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400042642

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400042642 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G79900.1 +2 6e-142 413 216/299 (72%) Mitochondrial substrate carrier family protein | chr1:30052524-30053599 REVERSE LENGTH=296

Transcript Sequence (1432 bp)

>PGSC0003DMT400042642 1432 pgsc_dm_v3.4
CCAATATCAAATTTAATTTATTACTTCATCATCGTCTGCTTTTAGAAAATACAAAAAAAG
GAGAAAAATTTAATCACGTCACATTTTAGCAATTGTTAGATAAGAGTTGGGCCAAATTAC
AACTGCATAATCTAATTCAGTTTCAGAGAGAAGAAACGGTTATAAAATTGAAGATTTTTT
TATTGGGGGAATTATTATAAATAAATATATGGATTTCTGGCCAGAGTTTCTAGCAAGTAG
TTGGGGAAAAGAATTTGTGGCTGGCGGATTCGGAGGAATTGCAGGTATCGTATCTGGTTA
TCCTCTTGATACCATTAGAGTCCGTCAACAGAGTTGTACGCCTGGCTCTGCTTTCAACAT
CCTCCGCCATGTTGCCGCCACTGAAGGTCCCCTGGCTCTCTACAGAGGCATGGCTGCTCC
TCTCGCTTCCGTCACATTTCAGAATGCTATGGTATTTCAGATTTATGCAGTGCTATCGCG
AGCATTTGACAGGAATGCTCCAGCCAGTGATCCACCCTCCTACAAAGGAGTGGCCTTAGG
TGGATTTGGAACAGGAGCATTACAAAGCCTAATGCTCACTCCTGTCGAACTTGTGAAAAT
TCGACTGCAGTTGCAACAGAGAAATATCCTGGATAACAAAAAACAAAAAACAAGTTGTAA
GGGTCCAACTGATGTGGCAAGAAACATATTCAGACAAGAAGGATGGAGGGGAATTTATCG
CGGATTAACAATTACAGTCCTCAGAGATGCACCAGCTCACGGCCTATATTTCTGGACATA
CGAGTATGTTAGAGAGCAACTTCATCCAGGATGTCGTAAGAATGGTCAAGAGAGCTTTAG
AACAATGCTTATAGCAGGTGGTCTTGCAGGAGTAGCTAGCTGGATATGCTGCTATCCGCT
GGATGTTATCAAAACTCGATTCCAAGCTCAGTCACAATCTACACCATTGAGATATACTGG
CATTGTTGATTGCTTCAGGAGAAGTGTGAAACACGAGGGATACAATGTGCTCTGGCGAGG
TTTGGGAACTGCAGTTGCCAGAGCATTTGTAGTGAATGGGGCTATATTCACTGCCTATGA
AACTGCCTTAAGGTGCCTTTTCATCAACAACAACAATAAAGTTCACGCGAATATTCAAAC
TGAAAATGCATTCTAATACCGGAGTAAGTAGTCATTGAGTTGTGTTGTCTCATTTTATAT
TATTCATTATAGCAATTGTATGGTTTATACCTCAAGCTGAAATGTAATATTAGTCTTTTC
TTATCAACTTGACTTCCTGTGGACATGGTTTAATTATAATATTTCGTCACTTTCTGTGAA
ATGTAGCTTTCATGTATGTAGTATACTCCAAAGGCTTCTAGGATCTGGGCTTCAGCCATT
ATAGGTGTTGAGATAGCCTTCTTGATCTCTTCAATTAGACATACGTCCGCCA