Microarray Probes on PGSC0003DMT400042620

Probe IDChipProbe Sequence
CUST_31440_PI426222305 JHI_St_60k_v1 GATACTGGTAGCTGCTTTGCTGTAACAAGAAATATTGGTAGTATTGTAGTACACAATTGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400042620

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400042620 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G79820.1 +1 8e-174 380 191/283 (67%) Major facilitator superfamily protein | chr1:30022581-30026771 REVERSE LENGTH=495

Transcript Sequence (2368 bp)

>PGSC0003DMT400042620 2368 pgsc_dm_v3.4
GAAAAAAAAAGAAAACGAAAAAGCAACAGCATTGGAGCAGGTGTACCGTCTCAGAGCTCT
CGTAGTTTTTAGATGCTTTCGTGTCGTCATTCTCCTTCCTTCCATGGAACCACTGCATAT
GCACTTGTTTGTTTGCTTACAAGTGAAAACACGTTAGCACCTTTTCTAAGATTTCTCTCC
GTCCCTTTTGCATTAACACGTTTTCCTTTTCACTTTTTCTTAATTAATTCCTTCTAAAAC
TTCACTACCAATATGCAATAGCTAGCCACTCCATTTTCTGCCTCACAAAACGTTTTTTTT
CAGGAGGTTGGCGTATATGATTGGGATTTTTCTTACATTACCATAAAACAGATCACACAA
TATGAGAGGTGGTGGTCTTGCAGATGCTTACTCCATGTACAAGCGCGCATCAACTAAAGA
CCAGTTCACTGATTATGAAGATAGAGAAGAAAATCTAGATCGTACCGAAAATGGTGTGTG
GAAAGAAATTGGAAACCCCTCATGGAAGCGGCCGTTGCCACATATACTGGTGGCAATTAT
TTCATCACTCTTGTTTGGCTACCATCTTGGGGTGGTTAATGACACTCTAGAAAGCATGTC
TTTGGACCTTGACTTCAGTGGCAGCACCTTGGCTGAAGGTCTAGTTGTGAGTACATGTTT
GGGAGGTGCTCTTTTGGGCTCTATATTCAGTGGTTGGATAGCAGATGGGGTTGGTCGTCG
GAGAGGCTTTCAACTGTGTGCTCTACCAATGATAATAGGTGCTTCTATGAGTGCTGCAAC
CAGTACTCTTGGAGTTATGCTTCTTGGAAGGTTATTTGTTGGAATAGGGATGGGCCTTGG
CCCTGCTGTTGCTGCTCTCTATGTTGCAGAGGTTTCACCAGCTTTTGTTAGAGGCACTTA
TGGGAGTTTCACTCAGATCGCCACATGCCTTGGGCTCCTGGGATCTCTTCTTATTGGAAT
TCCTGCCAAGGATACTGCTGGTGGCGAGTTTGCTTTTGGATATCCACCATTCCTGCTGCA
TTACTTGCTGTTTTGATGGAATTCTGCGCTGAGAGTCCTCACTGGCTTGTTAAGAGAGGA
AGAATTGATTTAGCTGAAGAAGAGCTTGAAAAGCTTATGGGAGCATCACATGTTAAATAT
GCCATTGCAGAAATGTCAAAGACAGACAAAGGAGATGAGGTGGATAATGTTAGGTTTGGA
GAGCTACTGTATGGTCGTCATTTTAAAGTGGTTTACATTGGATCTGCCTTATTTGCTTTG
CAACAACTATCTGGAATAAATGCTGTATTTTATTTCTCTTCAACTGTTTTTAAAAAGGCT
GGAGTACCTACAGACACTGCAAATACATGCGTTGGGATTGTAAACTTAACAGGGTCTATT
ATTGCAATGATGTTGATGGATAGGCTTGGGAGGAAGGTGCTTCTAATTGGGAGTTTCTTG
GGCATGGCAGTCGCAACGGGTCTTCAAGTAGCAGCTGCGAGTTCATTTGTACCAAGCTTT
GCAGTTTTATACCTATCAGTTGGCGGGACCCTACTGTATGTGTTGGCATTTTCTTTGGGT
GCTGGTCCAGTCCCCAGCCTCCTGCTGTCAGAGATATTTCCTGGCCGGATTAGGGCAAAG
GCAATGGCTTTATGCATGGCTGCACATTGGGTCATAAATTTTTTAGTCGGCCTTCTGTTT
CTGCCGATGCTTGAGCATCTTGGACCACAAATAGTGTATGCGGTCTTTGCAGGTTTTTGC
TTGTTTGCAGTGGCCTTTGTGAAAAAGAATGTGGTGGAAACAAAAGGAAAAACATTACAG
GAGATTGAGTTTGCCCTTCTTCCGTCTCATTAGTTGGTGACTAGATCACACTCTATATTA
AGTTCAGATTGGAAAATGTTAAGGTCCTAGAGATTGAACATCCAAATTCTTTGCTATAGC
TATTTCTTGATTTGTACAATTTTGGAGTGTGTTCATAGGCAGGAAAGGCAGCAATGACGA
ACAATCAAGATAAAGATTGTCACAAAGCTAGTTTTCATAGGGCAATTGTCACTCTGCTTA
TTTTTGCTGCTTTTCTGCTCACTCCACTGGTCGGTGACTATTGCCTGAGGGAGCATGAAA
CTGCATCTGCCTCGGCCAGCAGTAGATCACATATATACTACAGAGTACCTATTGTTGTTA
TTTTTGTATACCCTTTCTTTTAATTTTTACCTTGATCTGATTTTTGTAACTAGCATGGCA
CAGAAAGGCTACTCTGAACATTCCTTACAGAAATAATGTTACAGATTTTGAATTAGAAAG
ATACTGGTAGCTGCTTTGCTGTAACAAGAAATATTGGTAGTATTGTAGTACACAATTGAT
TAATGTAGCTGAGATTTTTTCATATTTG