Microarray Probes on PGSC0003DMT400042608

Probe IDChipProbe Sequence
CUST_31588_PI426222305 JHI_St_60k_v1 TTGTTTCATCCTATAATTAATACATTCAAGGGCTCTGAGTAGCCTGAAATTTTGCATCCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400042608

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400042608 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G52140.1 +3 8e-23 90 70/186 (38%) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G16330.1); Has 114 Blast hits to 114 proteins in 15 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 114; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:19407559-19408185 REVERSE LENGTH=208

Transcript Sequence (845 bp)

>PGSC0003DMT400042608 845 pgsc_dm_v3.4
AAACAACTCTCCTCTAAATTAAAGCTCTCTCTTGGCTTTCATCAATATTTGTCTCTCCTT
CTCAAGTTAACCAACAAAAACTCACAGTTCAAAAAAAATAAAAAAATTCTCCGTACGTGA
AAATGGATCAAAAAATATTGCCAGTTATAGGGAAAAAGTTCTGGAAAATAGTTCGTGTGG
CTTATTTCATGTTGAGAAAAGGATTATCATCAAAGAGGAAACTAATGTTCGATCTCAACT
TATTAATGAAACGTGGTAAGATTGCTGGAAAGGCCGCGTTCCAAAATCTGATGTTTCAGG
GCCATAATAATAATAATATTCATCAATCGATTTCAAAAGAGTATTACGAGTTCAGCTGCA
GTAACAGCCCAGCTTTTCACCTCCCCTTCAACATCAACAAGCGCATTAATAAGCATAATC
AGCCTGAACACGACGACGTTTTAATGATGAACGCTGCTGTTTTGAAGGCATTAGAAATGC
TTCAGAGCGAAACAGCATCACCTGCTTTGCCTGGATTCGGAAGGACTCCAACGGTGAGGC
AATTAAGGATCACTGACTCGCCTTTCCACTAAGAGAAGCTGATGATAATGGTGACATCAT
TAGCCACGTTGATGAGAAAGCTGATGAATTCATTTCTCGATTCTACAGAGATTTGAGAAG
AGAGGCTGCATCTGCTTTTGCTTAATGTTTAACATTTTTTTTTCTTGTTGGGGTATTCCG
GTAATTTTTAGAAAAAGTTGAATGTTAAGAGTTTATAAATGTGATGATACCCTCCTTTAG
TTAATTTGTTTCATCCTATAATTAATACATTCAAGGGCTCTGAGTAGCCTGAAATTTTGC
ATCCA