Microarray Probes on PGSC0003DMT400042552

Probe IDChipProbe Sequence
CUST_31467_PI426222305 JHI_St_60k_v1 ATCTGGAGAGTATAGAATGTATGCAGACTGACTGTGTTTTCGATAGACTCTCGAGTCAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400042552

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400042552 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G25735.1 +1 2e-06 45 33/86 (38%) unknown protein; Has 31 Blast hits to 31 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 31; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr2:10975345-10975704 REVERSE LENGTH=119

Transcript Sequence (648 bp)

>PGSC0003DMT400042552 648 pgsc_dm_v3.4
TTATACTTTAGCTTCCAAAACTGTAACAAAAGTAAAAAGCTTTCAGATCACACACAAACT
GTTCTGTCTACTCTAATGGATGCCGGAGCATGGTGTGATTCCGACGACGGAAACTTCTGC
TGGAGGCGGTGTTACTCCGGTAGAGAATACAACCGTTTGGTATCCTATAAGTTGCCGGCG
AACAGATCAAGCAGAACGCCCATCTGGAGACTGATATGGAGGAAGATGAAGAAAGAGAAG
AAGCGGATTTACGATTGTTCAAATTCAATGCGGTTTTCATATGATCCTCATTATTATTTG
CAGAATTTCGATCAAGGTTCAATTTCGACCGATGTTGATGAACTTTCTCGTTCCTTCTCA
GCTCGATTTGCTGTTCCCTCCAGGATTTTCACCCATGACGAATTACTGGACTAATGGAGA
AAACAATAATAACATACTCACTGTCGTACCACAACTGAGATCTGGAGAGTATAGAATGTA
TGCAGACTGACTGTGTTTTCGATAGACTCTCGAGTCAAAAAAAAATACAATGGAGGAAAA
CAGGGTAAAATTTGTTGTCATTGTTATCATACAAATTACTAAACTGTAATTCATCTGTTA
TCTGTTGTTAATGATAAAAATTGATATGTGTAGACTGTTGATGCTCCG