Microarray Probes on PGSC0003DMT400042495

Probe IDChipProbe Sequence
CUST_18510_PI426222305 JHI_St_60k_v1 AGTCTCTGGGATTTTGTTTGGGAGGTTTATAGGAGTATATGCTTTTGTATTCGGTATATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400042495

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400042495 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G04630.1 +2 2e-28 109 65/160 (41%) Protein of unknown function, DUF584 | chr4:2332163-2332669 REVERSE LENGTH=168

Transcript Sequence (875 bp)

>PGSC0003DMT400042495 875 pgsc_dm_v3.4
ATGAAACAAAAAACAAACATCCCTTTCTCTTAGCTATATATAGTTGTTAGGCTTCCCCTT
TCTAGATGTCAAGCTTTTTAGTACTTCACCAGAAATAAAAAAAGTCCCAAACTTTTTCAT
TGTTGAGAGATCTAATTAGAACCAAAGAATGGAAGAGTTTAATAGCAACAGAAACAAAGG
AAAAACAGAGAAAGATGGAGACTTTGAAGAAGAAGATGTATGGGGTTATGTGAATGAAAG
AGATTCATCAAGAGTGAATATCCCAAGAGGAAAAAGTAACAAGTGTATGTTACATAAATC
ATCAAGTCCTGTTGAGATTCCAGAATGGTCCAAGAATAGCAATAAACAGAAATCAAGAAG
AGTTAGAACAGAGGATGGTTCTTCTTTCTCATCAGTTGCTTATTCTGGAAATGTCGAAGA
AGAAGAAGAAGAAGAAGAAGATGATTATGGTGATGGAATAGTGCCACCACATGAATATAT
AGCAAGAAGAGTAGCAAGAAATCAAATAGCTTCATTTTCAATGGTGGAAGGAGTTGGAAG
GACTCTTAAGGGAAGGGACCTTAGCAAATTAAGGAATGCCATTTTAACTAAGACAGGTTT
CTTGGAATAGCTAGCTACCTAATACTATTATCAACTAACAAAATTAGACCATCCATCTTC
ATCAATCATCACATGTTATTATCATTTTTTGGTATCATTAGATTACTACTCGTTATGTTT
AAGTATGGCCTTCTTATTTTTAGCAGAGATGCAATTTTCGGATTATTTTTTTTTATTGGA
GGAAAAAGTAAGGCAGTCTCTGGGATTTTGTTTGGGAGGTTTATAGGAGTATATGCTTTT
GTATTCGGTATATGATATATGAAAGACTCATTTTT