Microarray Probes on PGSC0003DMT400042447

Probe IDChipProbe Sequence
CUST_18420_PI426222305 JHI_St_60k_v1 GAAGTGACTCTTTTTTGGACACCCTTTGCCTTTTTCTGTATTGGGTATTAATTTTCTTGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400042447

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400042447 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G21870.1 +1 4e-15 72 70/183 (38%) HSP20-like chaperones superfamily protein | chr4:11603756-11604285 REVERSE LENGTH=134

Transcript Sequence (1003 bp)

>PGSC0003DMT400042447 1003 pgsc_dm_v3.4
AAAAAATAAAAAGTATAATAAGATGAGCAATGCCACCAACTTGGCTAGGCATATATAAGG
ACAAAATCAACTCTCTTTTCATCCTCCAAACCAACTAACCACCTCTCTTGCAGCCACCAT
TTTTTCCTCCTAAATCCTCTTCTTCTTTCCAAGAAAATGGAATTCTCAACTTTCCATCCC
TCAACATGGAATTCTTTTTTCACCTCTCCTCTCCTTTTTCCCTATCAGTTCATTCCTGAG
AATTATGTTCACTGGAGAGAGACCCCTGAATCTCACATATACTCTGCTGATCTTCCAGGT
AAACACACACACACACAGAAAAAAAAAATAGTGTTGAACTAGTTGAAGTGACTCTTTTTT
GGACACCCTTTGCCTTTTTCTGTATTGGGTATTAATTTTCTTGAATTTTGGATGTTATAT
TTTTTTTGGATAGGTGTGAAGAAAGAGGAAATAAAGGTGGAAGTTGAGGATTCAAGCTAT
CTGATAATAAGAACTGAAGCAGCCAATGAAACAACAGAGCCAATAAGGAGCTTTATGAGG
AAATTTAGGCTACCTGGAATGGTGGATATGGATGGAATTTCTGCTAGTTATAGAGATGGT
GTTTTGACAGTCACAGTTCCAAGAACACTAGTGAGAAGGGGATTTTTCATTGAACCAGAT
GACTTGCCAGAAAGCATAGTGAATCTTGGTGCTAGTGCTGCTTGATTATTTTGTTTCCAA
ACAAGATTTGGTTGATATTAATACCTAATCTTATTATTATTAGTATTATTATTGGGTTTA
GGGAGGGGGGTTTCAAGATTGTGCTCTCTTTGAGATTATGTACATAAGTTAGATCAATGG
TAATCCTTAAACTGAATTTGCTGTCATTCCAAAAACTTTTGAGCTTGAAAAATACTATAT
TTGTAACAAAAGGATGGAGTGCAGTCTATTTACCCTGCTTTTACTTCCCTTCTCCTTTTC
ATGTTCCACCCTCCCATTTTTATTTAAAAGTAAAAGAACAAAA