Microarray Probes on PGSC0003DMT400042190

Probe IDChipProbe Sequence
CUST_18253_PI426222305 JHI_St_60k_v1 CCGTCGCCGGTGATGTTTCTCAGTCAGTGAACAATTGGATTTTCAAGCCAAAATTTGAGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400042190

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400042190 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G10740.1 +1 0.0 640 292/376 (78%) alpha/beta-Hydrolases superfamily protein | chr1:3568343-3570466 REVERSE LENGTH=473

Transcript Sequence (1715 bp)

>PGSC0003DMT400042190 1715 pgsc_dm_v3.4
CAAGAATCACCATTTTTGAAGAAACAAAAGCTCCATTTTTTTCTGTTTTAATTCATTCTA
GGGGCTTCAAAAAGTTGTGGGGTGTTCTTGTTTTCTCTCAATTTGAGCATTTTTACAACT
TTTTTTTTGAGAAATTTCCACTAAGGATCTGTAGAATGATAGTGAAATGGTGGGTAACAG
CATTTCAACTGACAGAGCTATTTGTGAGTTCTTTGGTTCATTTGAGTTATGGGTTTTACT
TATTTAGCACAGCCGTCGCCGGTGATGTTTCTCAGTCAGTGAACAATTGGATTTTCAAGC
CAAAATTTGAGGAGATTGGGAGGACTTTCGTATTTTGCTGGTGCAGAGAAAAGGGATGAC
AAGGTTCTTGTTCCAGATTTGGGTTCGCTAACTAGCATATATGACAGGGCTCGTGGATTG
TTCTATTATTTGAAAGGAGGGCAGGTTGATTATGGGGAGGAACACAGTAAGGCTTGTGGA
CATTCCCAATTTGGACGAGTTTATGAACAAGGGCACTACCCCGAGTGGGATGAAGATCAC
CCTATTCATTTTGTGGGGCATTCAGCTGGAGCACAGGTTGTTCGAGTTCTGCACCAGATG
CTGGCTGACAAGGCATTCAAGGGTTATGAGAACACTTCAGAGAACTGGATCTTAAGCATA
ACATCATTATCTGGAGCACTTAACGGGACAACCAGGACATACTTCGATGGAATGCAACCT
GAAGACGAGAAGTCGATAATGCCTGTAAGTTTGCTCCAACTTTGCCGCATTGGAGTAATA
GTTTATGAGTGGCTCGACATTCCTTGGATGAAGGACTATTACAACTTTGGGTTTGATCAC
TTCAGTATGACCTGGGGGAAAGTTGGTATCCGGGGTCTTCTTGATTACCTTTTAGGGAAT
GCTGGTCCATTTGCTTCAGGGGACTGGATACTTCCTGATCTTACCATCCAGGGGTCAATC
AAGTTGAACAGACACTTACGTACATTTCCGCAAACATACTACTTCAGCTATGCTACCAAG
CATACCACAAAAGTTACGGGTTTTGCAGTTCCTTCTGGCATTCGAGGGATACATCCTCTG
CTATTCATTAGAGTCCTGCAAATGAGCCAATGGCGGCATCCTCAAGATGTTTCTCCTCCG
TATAAGGGCTATAGGGATGAAGATTGGTGGGACAATGACGGTGCTCTCAACACCATATCT
ATGACACACCCTCGTTTGCCGGTTGAACACCCTAGTTGCCTTGTTATTAAAGATTCTGAT
TGCCAGCCATTGCAACCCGGCATCTGGTACTATAAAATTATAGAAGGCGACCACATTCTT
TTCGTTGTGAATCGCGAAAGAGCTGGAGTTCAATTTGATTTGATCTATGACAGCATATTC
GAGCGCTGCAGGAAACATGTCTTAAGAAAGACAACAACACTGCCAAACCAAGTACCTCCT
GAATAGTCAGCAAGATACTTCTCTCATTGGTTTATAAAATTCTGCATTATCACATTCTTT
GTAATTGTTTTACACACTGACGAAAATCTATTTCGCAATTGAAATGGATTTTACGGTCAA
TGTCTCTCACATTGTTCGTCTGTATGTAATTTGTAACTCTGTTGTGGGGGGGGGGGGGGG
GGGGGTCTTCGGGGGGGGGGGGGGGGGGGATGTGACTTGAATAGAGATGTAAGTGACACT
TGATTTGCTGTAAAAAGATGAATATAGAATTCCAC