Microarray Probes on PGSC0003DMT400042159

Probe IDChipProbe Sequence
CUST_18302_PI426222305 JHI_St_60k_v1 AATGAGAAGGCACAAGAAAAGACATTAGTGTGTAACCTCGAGGTATCAACTTAATCTCTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400042159

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400042159 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G47890.1 +1 4e-62 218 157/425 (37%) receptor like protein 7 | chr1:17643976-17647035 FORWARD LENGTH=1019

Transcript Sequence (1331 bp)

>PGSC0003DMT400042159 1331 pgsc_dm_v3.4
GCTACTGCTTCTCTAAAACAAAATCAGCTGCAAGGTCCTATTCCAAAGTCACTCCTAAAC
CAGCGTGATCTATATTCTCTTGTCCTTTCGCACAATAATCTCAGTGGACAGATCGCTTCA
ACCATCTGCAATCTGACAAAACTGTTAGTGCTAGATTTGGGCAGCAATAATTTGGAGGGA
ACAATCCCACTATGTTTGGGTGAGATGAGTGAACTTATGATTTTAGATTTAAGCAACAAT
AGTCTTAGAGGGACAATTAATACAACTTTTAGTATAGGAAACCAACTTATAGTCATTAAA
TTGACGGGAATAAGCTAGAGGGGAAAGTCCCACAATCATTGATCAATTGCACATATTTGG
AAGTTCTTGATTTAGGTAACAATGAGTTGAATGACACATTTCCTAAATGGTTGAGAGCCC
TACCGAATCTGAAGATTCTAAGACTGAGATCAAATAAGTTCTTTGGCCCTATAAAAGATT
CATCGACTTACAAGTTTTGCTCAAATTCGAATCATAGATCTCTCATCCAATGGATTTAGT
GGAAATTTACCAGTGAGCCTTTTTGAGAATTTTGAAGCTATGAAAATAAATGGTGAGAAA
AGTGGAACCCGAGAGTATGTAGCAGATATGAATAACGTTTATTACGCAAATTCCTTTATA
GTTACAACAAAGGGGCTGGATCTAGAACTACCTCGAGTTTTGACTACCAACATAATTATC
GATCTCTCAAGGAATAGATTTGAAGGTCATATCCCAGGCATTATTGGAGATCTCATTGGA
CTTCGTACTTTGAACCTATCTCATAATCGCTTGGAAGGTCACATACCAGCATCACTGCAC
CAGTTATCTGTGCTTGAATCATTGGATCTCTCATCCAACAAAATCAGCGGAGAAATTCCA
CAACAACTTGCATCCCTCAAATCACTTGAAGTCTGAAATCTCTCTCACAATCATCTTGTT
GGATGCATCCCCAAAGGAAAACAATTTGATACGTTTGAGAATAGTTCATACCAAGGAAAT
GATGGGTTACGTGGATTTCCACTCTCAAAGGATTGTGGTGGTGATGATGGGGTAGCTCAA
ACGACGAATCCAGTTGAGCTAGATGAAGAAGGAGGGGGAGATTCATCAATGATCAGTTGG
CAGGCGGTTCTCATGGGTTATGGTTGTGGACTTGTTATTGGACTGTCCATAATATACATA
ATGTTGTCAACTCAATATCCAGCATGGTTTTCGAGGATGGATGTAAAATTGGAACACAAA
ATTCTTACGAGAATGAGAAGGCACAAGAAAAGACATTAGTGTGTAACCTCGAGGTATCAA
CTTAATCTCTA