Microarray Probes on PGSC0003DMT400042004

Probe IDChipProbe Sequence
CUST_21978_PI426222305 JHI_St_60k_v1 TCAGAGTCCGAAGCTGTTGATGTCATGGTATCACTAATGAAAGCAATAGCGCACTGTCAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400042004

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400042004 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G08650.1 +2 8e-98 296 149/278 (54%) phosphoenolpyruvate carboxylase kinase 1 | chr1:2752206-2753232 FORWARD LENGTH=284

Transcript Sequence (1126 bp)

>PGSC0003DMT400042004 1126 pgsc_dm_v3.4
TCTAAACGAAAAAAATAGGAGTCAGAAAAGTAGAGAAAAAAACAAAACATACGGAATGAG
TGAGTCACTGAAGCGAAATTATTGTGTGGGTGAAGAGTTAGGAAGGGGACGATTCGGCAC
CGTTTTCAAGTGTTACTCGCCGGCGACCGGTGAGTCATTCGCCGTCAAGTCTATCGACAA
GCGCCTAATCGCCGATGACGCCATAGATCGACAATGTCTTTACAACGAAGCGAAAATTAT
GCACTTGCTTTCGCCCAATCCTTATGTTGTTCGTGTTTTCGATATCTACGAGGACGATAC
TCACCTTGATATGGTTCTAGAGCTCTGCAACTCCGGCGATTTGTTCCAACGCCTCAGTAG
TCAACCGGTTTTCTCAGAGTCCGAAGCTGTTGATGTCATGGTATCACTAATGAAAGCAAT
AGCGCACTGTCACCGTCTCGGTGTAGCCCACAGGGATATCAAGCCGGATAACATTTTATT
TACCGACTCGAACGAACTGAAATTGGCTGATTTTGGATCGGCGGAGTGTTTCCATGAGGG
ACAGCTGATGAGCGGCGTGGTTGGAACGCCGTATTATGTGGCGCCAGAGGTTTTAGCTGG
GAGAAACTACAGTGAGAAGATCGATATTTGGAGTGCTGGTGTTATTCTGTATATAATGCT
TGCCGGAGTTCCACCTTTCTTTGGTGACTCGGCTACAGAGATCTTCGAGGCTGTGCTCAG
AGCTAACCTTAGGTTTCCGTCTAGGATCTTCCATTCAGTTTCGCCGGCGGCGAAGGATTT
GCTTCGGAGAATGCTCTCTAAAGACGTTTCTAGAAGATTCTCTGCTGAACAAGTTCTCAG
GCACCCATGGATGACTAGCAACGGAGAAATCAGAACAGTTGCGCCATTTTAGCTTCGAGC
AATCAGTTCTTCTTGGATGTAGATATAGTAAGTGAATATAATATGTACAGCTACCAATAT
ACCCTGGTCTAAATTGATTTGCTTCCACACAAATCAATTTGGAGTCGAGAGGTAACTGTA
GATGCATTAAATCCCCCATTGTTTTGTGAGGTTTTAATGCATCTTGTGAGATAATGAATA
AATCCTCTTTTTCCTTATTTGTGATCTTATCCAAATTTGGCAGTAG