Microarray Probes on PGSC0003DMT400041952

Probe IDChipProbe Sequence
CUST_22062_PI426222305 JHI_St_60k_v1 CTTCTTATATGAGTTTTTGCTCCGTCAAATTTTAGTATTTTCGTGCGGTGAATAATGTGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400041952

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400041952 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G22970.1 +2 2e-85 276 198/431 (46%) Protein of unknown function (DUF506) | chr3:8152592-8153881 FORWARD LENGTH=370

Transcript Sequence (2098 bp)

>PGSC0003DMT400041952 2098 pgsc_dm_v3.4
AGAAAATCATAGACAGTACAATTCACCTTCTTAACTACACCCACTCTATATAAGCTCCTC
AAAACCCACTCTCTCATTTCAACTTAACTTCACAAAAAACCAAAACTGAGATAAAAATAG
AAACAAAGAAGAAATGACATAATCATTTACAAATATAGGCCCACTTTTTCTCTCCTTCAC
ATAATTCTCTCCTTCCCGTGAAAAGGAAAGGTATTCCGGCGACTATTGTTACACTCATTC
TATTCTTGTTCAACTACGCTAACAACTCCGAAGAGTGAAAGGAAGAAAAAGGTATCAAAA
TTTGACAATTTTTATTTTTCTATCACATTTGGAAACGTGAAGATGATAATGGTGAACGGA
TTATGCGCGATTGTATTAATTGGTTTTTGATGTGTGAAAAGGGAAAGGTGAATTAGGTGT
GAATGAATTATGAATTCGCTGAACTTGATTTTCTTTTCAAAGCATTGATTTCTGTGAATT
TGCATGTATTTCTGTGATTAAGAATTTAGGCATTTAAAGGATTCTGATCTAGACACACAA
AGCGAGTAGGTTTTTAAAGCTCTGAGAATTCAGCAGAAAATGACAAAAGAATATAATTAA
GCTGTAGAGAGAGAGAGTTTTACAGTAGAAGAAGTTGTACCTGTTTTGGTTGTGGTTGAT
AGACATGCCTTTTCCGATGAAGGTTCAACCGATCGATTCTTCAACATACAGAGAATCGAT
CAAAAATGATGCAGTAAAGCCTTTGCTGAAATCACGACTTAAAAGGTTCTTTGATCGGCC
GTTCCCTAGTGTTTTACGGATTTCGTCGGCGGCTGAGAAGCCAGGTGCCGCCGGCGCTGC
TAATGATGGACCAGGCGCTGAGTTTGAGCCGAATTCGGTTTCTTTGGACAAATTGGTTCA
GAATTTCATAGAAGAGAACAATGATAAGTCGTCTGCCGCTAGATTTGGCCGTAAATGCAA
TTGCTTTAATGGCAACAACGATAGCTCCGATGATGAGTTTGATTTCGACTCTGTTACCAA
CTCCTCTTCGTTTGGGGATTCTTCCGATACTCTCAAGAGCTTAATTCCCTGTGCAAGTGT
TACCGAGAGGAATCTATTAGCTGAAGCTTCAAAAATCTTCGAAGAGAACAAATCTTGCAA
GCGTAAGGACGATTTGAGAAAAATTGTCACTGATGAACTTTTAGCACTTGGCTATAAAGC
TTCAATCTGCAAATCCAAATGGGAAAAAGCTTCTTCTACTCCTGCAGGTACATGCTTCGT
TCTTCTTATATGAGTTTTTGCTCCGTCAAATTTTAGTATTTTCGTGCGGTGAATAATGTG
CTTTTTTTTCTAAATTTATTCGATATATTCAGGTGAATATGAGTATATTGATGTGATAGA
GGACGGCGAAAGAGTGATACTCGACGTAGATTTCAGATCTGAATTTGAAGTAGCGCGATC
GACGGGAAGGTATAAATCAATTCTGCAATTGCTCCCGTTTATCTTCGTCGGCAAAGCCGA
TCGGCTTCTGCAAATAGTGTCAATCGTCTCAGAAGCAGCTCGACAAAGCTTGAAGAAGAA
AGGTATGCACATCGCTCCATGGCGCAATCCGGAGTATATGAAAGCCAAATGGCTCAGTCC
CTATACTAGTCTCGCACCTGCTGTGGAATCAAACGCGGCTGCTGAGATCACGGAGTCGGA
AAGTGAGTACGGTGAGTTGGACTTGATTTTTTCTGATAAAACGCTACCGTTAGACTCCGA
TCCAACAACAGATCCGTCGGAGAATACTTCCGGCGAGGAAGAGAAGCCGGTGATGATGAC
ATGGCAACCTCCGGCAGTGAAGCCAAAGAAAACCAAAGTGGTTGTCACTGGATTGGCTTC
CCTTCTCAGGGAAAAACCCTAAAAGATTTTGTTAATTCTAACATTGTGAATCTTTTGTTT
TGTTTAGCGAGTAATCGGAAATTTAGATAGATGAACGGAAACTGTTTTTTTCATTTTCCG
TTCCGTTTTCTGCTCCTCTTTGAAAGGGACAAAGGGTACTGTAATAGAATCTAGAACCAA
CCTCTTTGCTGTAATGAAAAAGTAAAGAATAAAGAAAATATTATTCTTAATATTTTAC