Microarray Probes on PGSC0003DMT400041449

Probe IDChipProbe Sequence
CUST_51751_PI426222305 JHI_St_60k_v1 GACATGGGTATTAAGTTTATATATATTGACCTTCGCCTCCTCCTAATTTATATAGTGGTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400041449

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400041449 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G70830.1 +1 6e-24 100 45/93 (48%) MLP-like protein 28 | chr1:26710203-26711395 REVERSE LENGTH=335

Transcript Sequence (890 bp)

>PGSC0003DMT400041449 890 pgsc_dm_v3.4
ATTGAATAATCATTGTAAATGATATCAACACTTGTCCTCTGCAATTTTCTTAGTGTCACT
ACATCTTTTTATTTCTAAGTCTTCAGTAAAATGGGTCTAAAATCTGTATTGTGTGTCAAG
ATAGAAATGAAGGCCAACAAAGATGTGTTTCATGATGTTTTTACAAATAAACCACATCAC
GTCTCTACTATGTCTCCTTTGCATGTACAAGGTTTTGATCTTCTTGAAGGTGACATTGGA
ACTGTTGGATCCAAAATTTGTTGGACATATACCCTTGATGGGGAAAAGAAGATCTCTAAA
CAAATACTTGAAGCTATAGATCATGAAAAAAAGGTGCTCATACTCAGAGAATTTGAAGGA
GATGTAACGGATAAATATGATAGTTTTAAAGCAACTCTTCATAATCGAAACAAAAGACGA
AATCGATTTGGTTAGCTGGACATTGGAGTATGAAAGGTCCAAATGATAATGTCCCTGAAC
TTATAAGTTTGCTGGACTTCGTTGTTGGTATGACAAAAGCTATTGATGATCACCATGCCA
ATTGATGGGATCTATGTTGCTCGGACTATTAAAAAATGTCATCAGGTGTGTGTCGAATTC
TTTAAAAATATTGCATTTTTTAAGAATCTGACATAAGTATGACAATATTTTTGAAGAATT
CGAGCAACTTAGGATGGGATCATATATATTCATGTGAGCTTTACATAAATTACCATATGC
TTTGTTTGTTGTTTGTCCATGTTGGTTGTGTACTTTTTTTTATGTTTGTTGTGCCTTTCT
CATGTAAGTGATATGTTGGCAACTATGTTAACCTGTGTGTTGTGTAATAAGACATGGGTA
TTAAGTTTATATATATTGACCTTCGCCTCCTCCTAATTTATATAGTGGTG