Microarray Probes on PGSC0003DMT400041410

Probe IDChipProbe Sequence
CUST_30912_PI426222305 JHI_St_60k_v1 TACTGGTGTCTTGACAGAACAACAACGGCTCATATGCCGTGGAAAAGTGTTGAAGGATGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400041410

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400041410 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G25270.1 +1 2e-37 143 74/109 (68%) Ubiquitin-like superfamily protein | chr5:8757577-8762002 REVERSE LENGTH=658

Transcript Sequence (1137 bp)

>PGSC0003DMT400041410 1137 pgsc_dm_v3.4
ATGGTTAGCAACGGTGCTGAAGATGTGCAGATTTGTGGAAGTGGTGAGGCTGAATGTCCT
GAGACCACAGTGCCAGTCCCTGCATTGAAGGAACAAATTGCGACAGTTACTGGTGTCTTG
ACAGAACAACAACGGCTCATATGCCGTGGAAAAGTGTTGAAGGATGACCAGCTGCTTTCC
GCTTACCATGTGGAAGATGGTCACACTTTGCATCTGGTTGTGAGGCAACCTTCATCAGAC
AGTACCCCTGATCCCCAAGCAACTGCTTCTGCATCAAGTGCTGGGTACAGTCAAGGAAAC
CGAGTGAGTCCTGGTGTGGTAGTTGGAACCTACAGCTCATCTGATCATGGAGATGGAATT
TTCCCTGATTTGAATCGCATTGTAACAGCTGTGCTTGGATCTTTTGGAATTGCAAGCGCT
GGCGGTGGGAATGCGGGGATTGATCTCCATGCCAAGCTATCACCTTCTGTGCTAGCTTTC
ACCCTTATTTCTTTCACCTTTTCAGAATTTAGAACCACAAATTTTACATGGGGGAAGAAA
GGATTTACCTTTACGCTAGATTTAAATCGTATGACATCTCTAAGTTCAGTTCTAGGTCAG
GAACATGGTTTGAATGGACTGAGCGTAGCAGGTATGAGGAAAGTAACTTTAAGCCTTAAA
GTCATGAGATGGCTAGTCCAAGTACTTATTGAAGCTTCAAAGGAGCAAAGAATGACAGTT
GGGAGATGGAAAACAAAGCATCACTTTGCTGAATTCTTTTGCACTCTTAAATACAATGAG
CATGGTAGGTATGCCAGGTTTATTGCAGTACAAGGGGGCAGCAGGTCAGTTATTATAACT
CCTGAGACTACATTAAATGATGCATGGATAGAAACAGCTCAGAAAGTTACAAAATTCATT
GGGGTCTCAGAAAGGGGTGAGAAAACAGCAGTTATTGGACAACATCAGATCAAATCTTCT
TTTGTTGAAGCCAACAGAAGCAATAAATGGGAGACAGAAGCAATTAAAGGTTTGACACCA
CAGATCACTCCCTGCAGAATCACCCTCCCTGGAAGCTCTATAGTTTCAGAAGACGATGTG
CTTGGCAGATGTATTGTGGGGAAACTTTTGGACATGAGCAAGAAACGCCAACTCTGA