Microarray Probes on PGSC0003DMT400041342

Probe IDChipProbe Sequence
CUST_51321_PI426222305 JHI_St_60k_v1 GATGATGACTTTGATGGTATTAGACTTGGTCCAATTGATGACTTTTATGGTGTTGTGATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400041342

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400041342 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G25600.1 +2 7e-69 215 122/161 (76%) Calcium-binding EF-hand family protein | chr3:9307367-9307852 FORWARD LENGTH=161

Transcript Sequence (981 bp)

>PGSC0003DMT400041342 981 pgsc_dm_v3.4
GTTTCCTCTCTCTTTCCCTCACACGGTTTCTCATTATATCATTATATCCAAAAAAAAAAC
ACATCTCAAACTTCTTCATTTCTCTCCTTCTATTTTCTTCAAAATATCGAGGTATTATTA
CGAGCTCAATAATAATATATACGTTCGTATAATGGCTAGCCTTCAATCTGATGAACAACT
CAAACAACTCAAAGAAATATTCGGACGATTCGATCTTGATCATGATGGAAGCCTCACACA
ACTAGAGTTAGCCGCGCTTCTTCGTGCCCTAGGGCTCAAACCAACGGGCGATCAAATCCA
TACATTATTAGCAAATATGGACAATAATGGCAACGGGTTCATCGAATTCGATGAACTCGT
AAATGCCATTATGCCTGATATGAATGCAGAAATTTTAATAAATCAAGAACAATTAATGGA
GGTTTTTCGATCGTTCGATCGAGACGGTAACGGTTACATAACGGCTGCTGAGCTGGCCGG
GTCAATGGCTAAAATGGGTCGCCCGTTAACGTATAAGGAGTTATCTGATATGATGCAAGA
AGCTGATACTAATGGTGATGGTGTTATAAGTTTTAATGAGTTTGCTAATATTATGGGAAG
ATCTGCTGCTGATGTTCTTGGATTAACGGTTTCGTAATCAGAAACGGATTCAGGATTTGA
ACTTTACAGGTCGGGTTTTGATTAAATTTTAGGTTTGAAATCTATTACTGTATGTATTAT
TTAACATAGAATTTAAGTCAAGGCTAGTGATTCGAATAAATTCCTAGCTCTTTTACTAGA
TTCGCCTCTTGATTAACCGGTATCTAAGAGCGGTTTTCCGATATGTTTTTATTTTTATTT
TTATTTTTAATTGTGACATTAATTAATGTTAGAAATTGGTGTTGGTTGATGAGTTGTAGA
TGATGACTTTGATGGTATTAGACTTGGTCCAATTGATGACTTTTATGGTGTTGTGATTTA
ATTTGTATTTTGATGTGCGAG