Microarray Probes on PGSC0003DMT400041328

Probe IDChipProbe Sequence
CUST_47132_PI426222305 JHI_St_60k_v1 GAAGAAAAGCTATTCTGAATTTTCCGTTGGATGCCGGAAAATCTGGTGCTCCGGCGAATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400041328

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400041328 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G07580.1 +2 2e-43 151 74/114 (65%) Integrase-type DNA-binding superfamily protein | chr5:2399525-2400349 FORWARD LENGTH=274

Transcript Sequence (845 bp)

>PGSC0003DMT400041328 845 pgsc_dm_v3.4
TAGAGACTCACACAAACATAAGCACAAACACCTTCACTACAAAATTTTCAGACTCATAGA
GACATAAACACAAACACCTTCACTGCAATTCTCAAAATACTGCAATATGACGAAACAAGA
TGAAGGTTTAACATTAGAACTCATACGACAACATCTCCTCGAAGATTTCACAACTACAGA
ATCATTCATCAACAGTCTCAATTCTTGTTTTTCCGATCAAATCTCCTCCTCCTCCGACAT
CTCCCCTGTTTTCACTTCAGTAAAAACAGAGCCATCTACATCCAATTCCCTTTCAGATTC
ACCCAATTCCTCATACCCAAATGAACCCAACTCCCCAATTTCCCGTTACTTCAATCTCCA
CTCCGATTTCCCCGAATTCAAAATTGATTCAGATACCATCCTCAGTCCAGTTTCCGACAG
CTCCGCCGGTTCTAATGAAGACAATAATAAGAAGAAGAATTACAGAGGGGTAAGGAGAAG
GCCATGGGGGAAATTTGCGGCGGAGATAAGAGATCCAAGTAGAAAAGGATCGAGGATTTG
GTTGGGTACTTTTGATACTGATATGGATGCTGCTAGAGCTTATGATTGTGCAGCGTTTAA
GATGAGAGGAAGAAAAGCTATTCTGAATTTTCCGTTGGATGCCGGAAAATCTGGTGCTCC
GGCGAATATTGGCCGGAAAAGGAGAAGAGAGAACAAGATGGAATTGGTGGAGATGATTAA
TTTGTAATTTGCATGAAAGTATGTTAATTACTTACTTAATCCTCTTTAAGTGATGTATTA
AACTCCATTACATTATAATTAATAGAGTTTTTTTTCCAACATATTATTAAAATATAATAA
AAAAT