Microarray Probes on PGSC0003DMT400041149

Probe IDChipProbe Sequence
CUST_34204_PI426222305 JHI_St_60k_v1 TGCTAAACACCCTTCAATTTTAAGAGAATCGATTAGTCCGTATCCATTCCAGTGTAGTCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400041149

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400041149 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G43020.1 +2 2e-52 182 83/102 (81%) polyamine oxidase 2 | chr2:17891945-17894440 FORWARD LENGTH=490

Transcript Sequence (1052 bp)

>PGSC0003DMT400041149 1052 pgsc_dm_v3.4
CTAAAAATATTTGAGTTTTCTGCTATTTCCAATCTTGACTTCTGCAAATCGGTTGAACCT
TTTCAAGAGATCACATTTGGTTAGCTTGAGATTCTGTTAGCTGATCAGGAGAAAGAGAAC
TACTCTAGGAAGCAAATATTGTCTGTGTCTTGCTTTCATATTATGTAATGATATTCACAT
AGCTCACTATCTTTTCCTCCTGGTCTTTCTGCAGATCCAACATCTTGTTTCTCATTGGGG
TACAGATGTAAACTCACTCGGATCCTACAGCTACGATGCAGTAGGGAAGCCTCATGAGTT
CTATGAAAGGCTGAGGATACCGGTGGATAACATATTTTTTGCTGGAGAGGCGACGAGTAT
GGATTACCCAGGTTCTGTACATGGTGCATATTCAACAGGACTAATGGCTGCTGAGGACTG
CAGGATGCGTGTCCTAGAGCGGTACGGAGAGGTGGATCTGTTCCAGCCAGTCATGGGTGA
GGACACTCCTGTTGCTGTCCCCTTATTGATCTCCCGTATGTAACTAATTTAGTTCCCAAT
TATATATGTATAGACACAGTATTTAAGTGTCATATGGGATTGGCTTAACACATCGTGTGC
TGACTGCTTAGTGAAAATTGTGGAAACTACAAGGTTCCTCAATGAATGATCAAGTGTTAG
CGAATGTGTAGTCATCTGTATGCAGTGTTTATGGCATTTCTAAGTGAACTAGGAGACAAG
GTCTGCTAATATGTACGATGATGCAGCTGTGGAAATAAGGTCAGACTGGTTACATCTGCA
AATCGCGGTGTTTTAAGTGCATCTTTCAGTTTAACAGCTATTAGCTAATGCGTGTAACAT
GAACTATGCTTGTATAAGATGATGTGTGTTTATCTAAGACAATTTATTCTCATTTGACAT
CATTTTAGTAGTTGAATTCTTCAGTATATATTTGGCTAAAGGAAGTGAAATTACATAATC
CATGGAGCTCTGCAAGTTGAAATTGTCAACTTTGCTAAACACCCTTCAATTTTAAGAGAA
TCGATTAGTCCGTATCCATTCCAGTGTAGTCA