Microarray Probes on PGSC0003DMT400040330

Probe IDChipProbe Sequence
CUST_30984_PI426222305 JHI_St_60k_v1 AATATGCTATCCATTTCAAGGCTGAGGAATCAGCGAGGAGATGGAAGTAGATTGGGCTCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400040330

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400040330 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G70180.2 +2 4e-18 88 64/153 (42%) Sterile alpha motif (SAM) domain-containing protein | chr1:26426768-26429097 FORWARD LENGTH=460

Transcript Sequence (2692 bp)

>PGSC0003DMT400040330 2692 pgsc_dm_v3.4
ACCACCACCCCACCCCCACCCCTTCTACATCTCTTGCAGTGAAACCCTAAAGCCCGATTT
CAAGTTTCATATCGGAGCTGCTGTTTCGCCATTTCTGAAGGATTTTGATGGTATAGTTCC
GGCCTATACATTGATTTGCCGAGATAGGGGCTTCGGAGTTGTTAAAATGGCGGAGGCTTC
GAGTTCTCGAATTACAATCACCCTAGGACGCAGCGGTCAGGTGGTAAAGAAGGCAGGACC
TGTATTAGATCATCCCTTTCCTGATTCAAGGCCAGCAGTTGGGAGTAAACGGTCTGTCAG
AGATAGACTAGGTAGCATTGCAGATTCAACAACTGAATTCAATAATAAACGTCAGCGAGG
AGATGGAAGTAGATTGGGCTCTCGTGCCTCTAGTGGCATTGAAGATGGGCGGCTTGGTAA
AGATGACCTGCGATATAAAATCATGCGGAAAACTGCACTTGACCGAGGCCAAAGCAATGG
CCAGCAGAATGGGGTTGATCTTCGTGATTTCCTATCAAGGCCTGCTCAGTCTTCAACAGC
AAAACCTAGTTCACGGCAGCACATACCTGATCAGAGGGATAATAGACAACGAGTACCTGA
GCCGAGGGATAATAGAGCACGAGTACCTGAGCCAAGGGATAATAGAGCACGAGTACCTGA
ACCGAGGGATAATAGACCACGAGTATCTGATCCAAGGGATGATAGACAGCATATGCTTGA
TTCAAGAGGTTCTAGAGAATATTTGCCTGAAATCAAAGATTCAAGACAGTACATGCCTGA
AGCCAGGGATTTTAGAGGGCACCGTCCGGAGCTAAAGGATGGTAGGTATAATACACCCGA
GTCAAGGAGTGTGAGCATACTGGGACGAGCTCCCTTGGCAAGAAATGCAGATGCTTTACC
CATGATGGACTCAATAAGGAATTCTTATTCCCCCTGGACACTGGATCGTTTAAGGCGAAG
ATCACCAGATGGAGTTCATAGTTCTTCTAGAGGTATTTCACCACCAAGGAGAGGGGAGGA
ACTGCAGAGAAGACCTCCAGTGACGCCTTATGACGACCCGAGACTCAGTTCATACACAAG
GAAAGATGTCTCTGAGCTTTCACGCCCCATGACTTCTGCAGGTTACCTGTCAAACACATC
CCAACCTGCCGGGCCTGGAAAGACTGTCGCACCATTTCGTGCCCCAATCCCTCAATCGCG
GAGTCTAGTGCAGAAAAGTTCATATGCAGTACAATCTACTTGACTTTATGCCTTTTCTTT
GTTTCCTCTTTTACTATGTTGAGATATTGATAACTTAGATGATTATATGGTGAGATTTTC
TCCTGATAATCAAACATTATATTTATCCTATTCCCAGGGCTGCAAACTACTTCTGCCATC
AAGTATGTGAGCTCTGATAGTTGAAGTGCTATTCTGCATCACTTCCATACCAATATTAAT
TACAACAGATGCTCATAAACATCAAGTTGTTTTCTTGTAAAAACATATATTTTGTAGATA
AGAGTTGCTAAAAGAAAAATGGTTAACCTAGTCCAAAGTAATAATGAAAGAGGGCTTTGC
TTGTTTGTGATCATCTGTTATCCATTCTTGAGAATTATTACAAATGTCCCTTTTTGGATA
TTTTTTGGCTCTTCATATTCTGTGGTTGTGTTCTTTACAATCATTTTGGTGTTTGTGCAC
TTTGCACCTTCTTGACTTTATTCTTCTTTAAAAAATTATTCACATTTTAAGTAGACTAAC
CTCACTGGGTCCTGGAAAAATTTGATGTTGTATGGTGGAATTATGAAGCGTGTATTCTCA
TTCCCGATCAGAGATAAAGTGGTATGCTTAGCTACTGACATGATTAGACATTTTTACTTT
CTTGTCTGAAAAATTGGGCCATAGCCATGTCTTGATATATTGCATACTGAGCATGATGGA
TAACAATTGGAGGTTAAAAAGAACATAAGAAGTTAAAAAAATTTGGTTTACTCCTCTCTA
AAAGTTCTTTCTCCTTCCTTTAATGCAGGTTGAGGATCAACCTACTGTTGATAGCTTTTT
GCACTCGTTGGGTCTAGAGAAATATGCTATCCATTTCAAGGCTGAGGAAGTGGATTTGTA
TTCACTGAAGCAGATGGGTGACAATGATCTGAAAGAGTTGGGAGTTCCCATGGGTCCGAG
AAAAAAGATTCTGCTTGCATTAGCATCTCGTGCCAGGAGACAAGTATGATTACATGAACT
GATGCAATTCAGATACATTCTGGAGCTTTGACACAAAAACCATGAGAGCTGAAGTGAGAT
CTTGCAACTCTGCATATGCCTTGTAGTCTGTAGAGCATGTATTTTCCTTCTCGTTCTAGC
TGGGCGAATCTGTATGGATCAGTTGTTAGCCCCTTGTCGATTCTGTAGTTTCCTACATAG
GGCAAAATATTTTGCCAAAAGCAGTCTGATTCTTTTGTTGTTTGCTACTATTTTGTTTTT
GTGCTATCCTCATTGTTATGGAATTACACACCAGTAAACCCTCCGGCATGAAAACAAAAA
AGTTTGTGACGTTAAACATACCATCTGGTGCTGATACCCATTTAAGGTATTTTTCAACCC
GTTGTCGATCAGCTTTCTTTTTTGGTATGAACTACATGTAAGATATGGAAATGCACGAGT
GTCTGTGCGAACTATTTTCGTCTTGAACTATGTATGTGTGTGTGTGCGCTCG