Microarray Probes on PGSC0003DMT400040247

Probe IDChipProbe Sequence
CUST_31024_PI426222305 JHI_St_60k_v1 CCTGGATTTATTAAAGAGCCTGAAAGTTATCCTGCTTATTTAGCTATGAAAATGAGCCAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400040247

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400040247 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G24100.1 +1 6e-162 473 242/459 (53%) UDP-glucosyl transferase 74B1 | chr1:8525547-8527010 REVERSE LENGTH=460

Transcript Sequence (1680 bp)

>PGSC0003DMT400040247 1680 pgsc_dm_v3.4
GTTTGGTTTTCTTTATTTTATACCAAAAAAATGGCCAAAGTCACAACAATTGAGCCTCAT
GTTATATTAGTACCATACCCCAGCCAAGGTCACATTAATCCACTTCTCCAATTTGCTAAA
CGTTTAGCTTCAAAAGGTGTTAAATCAACAATAGCCACAACTAAATACACTGTTAACTCT
ATTCATTCACCTAACATCTCTGTTGAACCAATTTCTGATGGATTTGACGAAGGTGGTTAT
ACTCAAGCCCAAAATACAGACGTATTCCTCAAATCGTTCAAAGAAAATGGTTCGAGAACT
CTATCACAAATACTCACAAATTACGAAAATTCAACACATCCTATAAGTTGCATTGTTTAT
GATTCCTTCTTTCCATGGGCTCTTGATGTCGCGAAAAAACATGGGATATATGGAGCATCT
TTTTTTACGAATTCAGCTATGGTTTGTGCTGTGTTTGCTCATATCCACCATGGAACGTTT
TCGTTGCCCGTGAAAATCGAAGAAAATGAGCCATTGTTATTGCCTGGTTTGCCTTGTTTG
TACCCAAATGATGTTCCTGGATTTATTAAAGAGCCTGAAAGTTATCCTGCTTATTTAGCT
ATGAAAATGAGCCAATTTTCTAATGTTGAAAATGCTGATTGGATTTTTGATAATTCTTTT
CAAGAGCTTGAAGGAGAGATAGCAAGAGGAGTTTCAAAGTTTTGGCCAGCAAAGTTGATA
GGACCAATGGTGCCATCTTTATATTTGGATGGAAGAATAGAAAATGACAAAGGTTATGGA
GCAAGTCTATGGAAACCCCTTAGTGAAGAATGTCTCAATTGGCTAAAAACAAAGCCAAAA
CAATCAGTAATTTACATTTCATTTGGAAGTATGGTATCACTTACACAAAAACAAATGGAA
GAAATAGCATATGCTTTAATAGGAAGCAACATGAATTTCCTTTGGGTTGTAAGAGATACT
GAAGAATGCAAATTGCCTAAAGGATTCATAGAATCCACAAAAGGTAAAGGACTCATTGTG
TCATGGTGCAATCAGCTCGAAACGCTAGCAAATCAAGCTATTGGTTGTTTTGTGACTCAC
TGTGGATGGAATTCGACTCTTGAAGGACTAAGCCTTGGCGTACCAATGGTGGCTATGCCT
CAATTTTCTGATCAAATGACGGATGCTAAGTTTATAGATGAGATATGGGAGATTGGTTTG
AGGCCTAAGTTGGATGAGATGTTAGGAATTGTTAAAAGAGAAGAGTTGTTATTTTGTTTA
AATGAGGTAATGAAAGGGGAAAAGAGTGTTGAGATTAGGAAAAATGCAACAAAATTGAGA
GATTTGGCTAAGAAAACAGTTAGTGAAGGAGGTAGCTCTGATAAGGCTATTAATGAATTT
GTGGAAAGTCTAAATTTAGTTTGCTAGATGAAGTAGTAGACATTCTTGATTGCTTAGCAA
TCAAATATGGTTTTATTGTTAGTGTTATTTTCATGGCTTAGCTCATTAGAGAGCAATGAA
GATTAGGTTATATGATTTTAAAATTTTCTCATCTTATATGACCTTTTGAAATGGGAAGTT
ACTTTTAATGTTTTGTGTTAATTGTACATTTATAATTTGGATTAGGATTACTCATGTTCT
GTATTAGTTGTTATGTTTTACTTTTCAAAAGTTAATTTGACTATTTTTCAAAGTTACATA