Microarray Probes on PGSC0003DMT400039522

Probe IDChipProbe Sequence
CUST_22496_PI426222305 JHI_St_60k_v1 ATTTCTGACTTGCAAGTGTATAAAATGCAAACAGTTCTCCGGAAACTATTCAAATGCTAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400039522

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400039522 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G73390.1 +3 0.0 659 338/413 (82%) Endosomal targeting BRO1-like domain-containing protein | chr1:27591079-27594148 REVERSE LENGTH=419

Transcript Sequence (2284 bp)

>PGSC0003DMT400039522 2284 pgsc_dm_v3.4
AATTTTCTCTCTCTATCTCTATCTCTATCTCTATCTCTCTATTTGTGACGATTGCTTATC
GAGATTTCAACTGTCCGTTGAAGATTGAAGAAGCTTCCTTTATTTTTCTTCAACTCTTTT
TAAAGACCCATTTTCTGTCTGTATTCCTCTCTATTTATTGTCTTTGTCACTTTTTTTTTT
CTTCCACAAATGTTCCAAGATTGAAATTTGCCAGCTGATTTTACAACCAAGTTGAGGTTG
AGTTGATTCCTTTGTATTTGCCTTTTCACAGAGGATTTGGGTTTTGCTTAATTAAGCTAA
AGAGTTTCTATAGTAGGGTTTATTTGCTTCATTTTGAATCAATTCCCAGAAAATACGAAC
CCCATCTTGTTGTTTTTTATGGAAAATTTTGGCTCCTCTGTTTCAAACCAGAAATTACTA
GAGAAATTGACCTATTGCCTAATCTGCTGATTATAAAACCAGGTGCTCTGGCAGATACGA
GAAGATTTTAGGATATGGGATGCTTTGTTTCGACGCCGCAGGATACTGGTGGGAATAGAA
GGCGGCCAGGAAACATTGGCGAGGTGTCTGTATTTGTTCCCGGATTACGTATCCCTAAGC
CAGTTGATTTATCTCTTGCACTTGGTGATCAATTGTCGAAAACCCTGGTGGAGCGCCTTT
CCGCTCTCAGGACCAGAATAGTGGTTATGGCAGGGCAAGAAGCTCCCACAATTACAAGGA
CAAGAAGGAAAACTGCTACTCAGCATGGAGGTTCAACCCTTGCTGATCTATTGCAGGCTC
TCGAAGATTATTTGCCTGTTCTTTTGGGGCTAGTTAAAGATGGTAGCACATTACAGCATA
AAGTGCAATTTATTTGGGTCAATCAAGAGGATGATGCAGAGGAAACTGCAATGTTTAGTG
CTTGGTATGAAATACTGTCCGTTTTGCACTTGATGGCAACACTATCATTATCGCAAGCTA
ACTTGCTGCTTCTTCCTAGAACATCTCTTGATGGTTATTCACCAAAGGTATCTGAAGAGA
GCAGGCGATCTTCTGTTGATATTTTCCTAAAGGCTGCTGGATATCTTGATTGTGCAGTTC
GAAATGTTCTTCCCCAGTTGCCAGCCGAGCAAAGGAGAAACCTGCCGGTAGACCTCGCTG
AAGGAGTTCTGCGAGCATTGTGCCTCCAAGCATTAGGGCAGGCCGTTGATATTCAACTTG
GACTTGCAATTGACAGTACTAAAGCAACACTGGCTGTCAAAAGAAGGCTTGCTTGTGAGA
TGGTAAAATACTGGCAGCAGGCTCAAGATAACATCATGAACCTTCCATTATCAAATGGTT
GGGGAGAAAAGCATAGGCTTTTCGTGAAGTGGAAATATATTGAAGCCAAGGCTTCAGCAT
ACTATTATCATGGTCTAATCCTTGACGAAGGAAACACAGAAAAATCTCATGGAATGGCGG
TAGCTGCCCTGCAAGCAGCTGATGAGTATCTTAAAGAAAGTAAGAAGGCATGTGAGGCTT
TCAATGCAGCCATTCCTCTCTCCAGAAATCCTCCACTTTGGGGAACGATGAAGTATCTTG
CCGAGAAAATCCCAAAGGACACTTCGAGCAAGGTGCGGATCAACAGGGATTTGTACTCTT
ATGAAAAGATCATGGAAACAGCCCCAACGCTGCCAGACTTTGCATTGGCTCTCAAACCTG
ATGAATATCAGCTTCCTCATGTGGATGCATCTTGGGATGATGAAACTTACAGGCAGGGGA
CAGCTTAACCCGAACAAGCTCAAAGGGTGACTTATTCAGCTCATCAGATTTCAGACTCTG
GAAAATCCAGACTGCTTGAAAATGCAGCATGACTGTCGTCATATCTCCAAGATATCAAAC
TCTTGCTATTCGCCAAAGGTCCCCTCTTTGCTGCACCTCTAGTTGAATGTGATCTCTATT
TCTTCCAGTAAATTTAATCTTTATTTCCTTTTTCCAATTAGATGTATAGTCAACCCTGTG
AGTGAGTTCTGTACAAGTCGCTTTGCTTTTGTTTGTAATCTTTGATCAACAGGAAAAAGG
ATGTATTTCTTTCCCAGCCTACCAAATAATTTCTAGTTCCACTTGTCCACCAACATGAAG
CCAGAACCAATTGTGCAAGTTGTTTGAAAGAAAATGCTTTTGTATAAATTCCACAATTTG
TGTCTTTTGAAGAAGCTTATTAGCTAAAAGAACCTCCTCTGTATCTTTACTTTTTTCAAT
TCCAATTTCTGACTTGCAAGTGTATAAAATGCAAACAGTTCTCCGGAAACTATTCAAATG
CTAG