Microarray Probes on PGSC0003DMT400039518

Probe IDChipProbe Sequence
CUST_22489_PI426222305 JHI_St_60k_v1 ATTTCTGACTTGCAAGTGTATAAAATGCAAACAGTTCTCCGGAAACTATTCAAATGCTAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400039518

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400039518 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G73390.1 +2 1e-85 270 130/152 (86%) Endosomal targeting BRO1-like domain-containing protein | chr1:27591079-27594148 REVERSE LENGTH=419

Transcript Sequence (1221 bp)

>PGSC0003DMT400039518 1221 pgsc_dm_v3.4
GGGCATCTCTGAATGTCACACTTATTGCGATACGGGTAACTTGTTTATTCCCAACTAGCT
GGCATTGGGTATGCGGATCATTTGCTTCCATTGGAGTCCTTGGTCCTTTAAACTCCTTCC
CCTAACATAGTAATAGAAAGAGGAAAATAAAGCTGTGTTACTTTACTCCAGGTAGTGTCT
GAGATATCAACTACTTTGTTTTTTTGTTACCATGCAGGCTCAAGATAACATCATGAACCT
TCCATTATCAAATGGTTGGGGAGAAAAGCATAGGCTTTTCGTGAAGTGGAAATATATTGA
AGCCAAGGCTTCAGCATACTATTATCATGGTCTAATCCTTGACGAAGGAAACACAGAAAA
ATCTCATGGAATGGCGGTAGCTGCCCTGCAAGCAGCTGATGAGTATCTTAAAGAAAGTAA
GAAGGCATGTGAGGCTTTCAATGCAGCCATTCCTCTCTCCAGAAATCCTCCACTTTGGGG
AACGATGAAGTATCTTGCCGAGAAAATCCCAAAGGACACTTCGAGCAAGGTGCGGATCAA
CAGGGATTTGTACTCTTATGAAAAGATCATGGAAACAGCCCCAACGCTGCCAGACTTTGC
ATTGGCTCTCAAACCTGATGAATATCAGCTTCCTCATGTGGATGCATCTTGGGATGATGA
AACTTACAGGCAGGGGACAGCTTAACCCGAACAAGCTCAAAGGGTGACTTATTCAGCTCA
TCAGATTTCAGACTCTGGAAAATCCAGACTGCTTGAAAATGCAGCATGACTGTCGTCATA
TCTCCAAGATATCAAACTCTTGCTATTCGCCAAAGGTCCCCTCTTTGCTGCACCTCTAGT
TGAATGTGATCTCTATTTCTTCCAGTAAATTTAATCTTTATTTCCTTTTTCCAATTAGAT
GTATAGTCAACCCTGTGAGTGAGTTCTGTACAAGTCGCTTTGCTTTTGTTTGTAATCTTT
GATCAACAGGAAAAAGGATGTATTTCTTTCCCAGCCTACCAAATAATTTCTAGTTCCACT
TGTCCACCAACATGAAGCCAGAACCAATTGTGCAAGTTGTTTGAAAGAAAATGCTTTTGT
ATAAATTCCACAATTTGTGTCTTTTGAAGAAGCTTATTAGCTAAAAGAACCTCCTCTGTA
TCTTTACTTTTTTCAATTCCAATTTCTGACTTGCAAGTGTATAAAATGCAAACAGTTCTC
CGGAAACTATTCAAATGCTAG