Microarray Probes on PGSC0003DMT400039507

Probe IDChipProbe Sequence
CUST_22473_PI426222305 JHI_St_60k_v1 AATACTTCTGTATGTAGCTGCACATTTCCAAGACGATGATCCCAGACCAGTAATAGCATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400039507

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400039507 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G17810.1 +1 2e-122 357 186/267 (70%) beta-tonoplast intrinsic protein | chr1:6130209-6131442 FORWARD LENGTH=267

Transcript Sequence (1034 bp)

>PGSC0003DMT400039507 1034 pgsc_dm_v3.4
GTTTTATCAGATTAAGATAAGAATCTTGATTTACATATTTGATCTGTAGTACTAAAGGTT
TTCAACATTGACAGCAGATTTATTGTAGTTATGGCTATGCCAGCTAGGAGATATGCTTTT
GGTAGGGCGGATGAAGCTACTCATCCTGATTCCATGAGAGCCACCTTGTCTGAACTCTTA
TCCACCTTCATCTTCGTTTTCGCCGGTGAAGGCTCTGTTCTTGCTATTGACAAGTTATAT
CCGGATACGGGGTTAGGTTCATCAAGACTGATAGTGATAGCGCTGGCGCATGCGTTTTCC
TTCTTTGCAGCTGTGGCTTCTAGCCTGAATGTTTCTGGAGGACATATCAACCCAGCTGTT
ACCTTTGGTTCACTTGTGGGAGGCAGGATTTCTGTTGTTCGTGCTATCTATTATTGGGTT
GCTCAGCTTTTTGGTTCTGTTTTAGCTTCTCTTTTGTTGAGGCTTGCTACAGATGGCTTG
CGGCCACGGGGATTCTCGGTTGCAGCAGGGGTGGGCAACTTGAATGCACTTGTGATGGAG
ATAGTGATGACATTTGGACTAATGTATACAGTATATGCAACTGCTGTTGATCCAAGGAGG
GGAAGCTTGAGCACCATTGCCCCTCTTGCCATTGCATTCATTCTGGGGGCAAACACCCTG
GTGGGAGGGCCTTTTGAGGGGGCATCCATGAACCCAGCAAGGGCATTTGGACCTGCTTTA
GTGGGTTGGAGGTGGAGGAACCATTGGATCTACTGGTTGGGCCCTTTCGTTGGTGCAGCC
CTGGCTGGACTTATATACGAGTATGGGATCATTCAGCATGAAACCGTTCCACGCCCGACT
ACCCACCAGCCCTTGGCACCAGAAGATTACTAGTCTCCTTCATTTGTGAATAAAAAAGGA
TTGTGCTTAAAAACTAATGTGATGTTTGTAGTCCAGTTTATGGTTGCTTTTTAATTCCAT
TTTCTGCGTTTAATACTTCTGTATGTAGCTGCACATTTCCAAGACGATGATCCCAGACCA
GTAATAGCATGAAT