Microarray Probes on PGSC0003DMT400039423

Probe IDChipProbe Sequence
CUST_22394_PI426222305 JHI_St_60k_v1 GAAGGTTATGCAGATGTAGAATGAAGGAAGTGAACGCACAGCATATTATTACTTACAATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400039423

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400039423 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G52180.1 +1 2e-156 452 237/380 (62%) dual specificity protein phosphatase (DsPTP1) family protein | chr3:19349884-19353459 REVERSE LENGTH=379

Transcript Sequence (1407 bp)

>PGSC0003DMT400039423 1407 pgsc_dm_v3.4
AACTGATTAAAAAAAACAAAAAGGAATTAAAAAATTGTTCATCTCATTTCTGTATCACAC
TTGATCAGATTCATATTATCCTACAAATCCATTCATTTTCCCAAAATGAATTGCCTTCAG
AATCTTCCCAGATCCTCTGGTTTACCGCTGAGAAGCTTCACAGGCAATTCAAGAAAGCCT
TCTCCCACTGTTGTTTCACTGGGGATGACAAAATTTGCTGAACAGCGTCTAAGTATTGTG
GCACAGGTAGTATCTGGTCCTGAATCTAGTACAGCAAAGGACAAGGATGCGGGAAAATCT
GATACATACAGTCATGACATGACTGCAGCTATGGGAGCTGTCTTAACCTATAGGCATGAG
TTAGGAATGAACTACAACTTCATCCTTCCAGATTTGATTGTTGGTTCATGTCTACAGACT
CCTGAGGATGTGGACAAGCTTCGCAGTATTGGAGTTAAAACTATTTTTTGCTTGCAACAA
AATCCAGATCTCGAATATTTTGGGGTTGATATCGAAGCAATTTGTGAATATGCCAACAAA
TGTGGTGATATTGAACATTTGCGAGCCGAAATAAGGGATTTTGATGCATTTGATTTGAGA
TTGAGGCTTCCAGCCGTAATAAGAAAACTGAACAATGCCATCAATAGAAATGGGGGTGTG
ACTTATATACACTGCACAGCTGGACTTGGCAGAGCACCTGCAGTTGCGTTGACATATATG
TTCTGGGTTCAATGCTATAAGCTTACTGACGCTGTCAGTTTACTCATGAGCAAACGTCCC
TGCTTTCCGAACCTAGATGCCATCAAAAGTGCCACAGCAGACATCCTTACAGGCCTTAAA
AAGACGCCTGTCACGTTGACATGGCGTGGTGATAATTGTACTACAGTGGAATTATCTGGA
CTTGATATTGGCTGGTGGCAGAGAATACCCTTAAAATTTGACAAGGAACAAGGTTTGTGG
ACTCTCCAGAGGGAGTTACCAGAAGGACACTATGAATACAAGTACATTGTTGACGGTGAA
TGGATATGCAATGAATTTGAGCCGATCACTTCTCCCAACAAAGATGGATATGTCAACAAC
TATGTAGAGGTTCTTGATGAAACTCCAGACAACATCACCAGTGCAGCAATACGGAAGAGG
TTCTCCGGTGATGACCCTGATCTTACTTCATACGAAGGGCTCATAATCGGACAATTTCTC
GAAGGTTATGCAGATGTAGAATGAAGGAAGTGAACGCACAGCATATTATTACTTACAATT
ATAAGTGTATAATTGTAAACAAAGCCAATAATCTGCTATAACTCATGCAGTGTAATTAGG
ATGTAGTTGTTTGTAGTATCAATAAGAGTTGTATGATACGTTTACAAGGAATGAAATGTT
GTAATGAAGTAACATGCTCCATCTTCT