Microarray Probes on PGSC0003DMT400039270

Probe IDChipProbe Sequence
CUST_22338_PI426222305 JHI_St_60k_v1 GATGGCTAGCTTGGCTAAAAGGTTGTTCAATTAGCATTTGCTGCTTGTTATATCTTTTGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400039270

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400039270 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G48520.1 +2 1e-153 346 183/316 (58%) cytochrome P450, family 94, subfamily B, polypeptide 3 | chr3:17975104-17976624 REVERSE LENGTH=506

Transcript Sequence (1673 bp)

>PGSC0003DMT400039270 1673 pgsc_dm_v3.4
CTTCTTCCTCTAAAACCTAAGAAACATGTTTCTCTCTCCTTTTATTTTCTTCATTTTAGG
GTTTCTTACCCATTCCCTAAAACTTCATCTCAAATTCAGAAAATTTTCTCCAATGTATGG
CCCTTCCTCTTACCCAATCCTCGGATGCCTTATTTCCTTCTATAAAAATCGACACCAACT
ATTGGATTGGTACACACAGCTTTTATCTGAATCCCCAACACAAACCATTCTAGTTCAGCG
ATTCGGTGCTCCTCGAACCATAATTACAGCAAATCCGAATAACGTTGAGTACATGCTCAA
AACGAATTTCATAAATTATCCAAAGGGGAAGCCGTTTACGGATATTCTAGGTGATTTTCT
AGGGCGTGGGATATTCAACGTGGACGGGGAGCTGTGGAGCGCCCAGCGTAAATTGGCTAG
CCATGAATTCAGCACAAATTCATTGAGGGAGTTTGTTGTAAAAACTCTGGAAGAAGTAGT
CGAAAACAGGCTCATTCCGTTGTTAATTCAGGCAGCTAAATCTGGTAAGGTGTTGGACTT
GCAAGACGTGCTTAGGCGATTCGCCTTTGATACAATTTGCAAGGTGTCGCTAGGTACGGA
TCCACATTGCTTGGATGATCTCTCTCACGTGCCAGTTCTCGTTGAGTCGTTCGACACCGC
TTCTCTAGAGTGTGCAATGCGTGGGATGGCGCCTGTTTACGCTATTTGGAAAAGCAAAAG
AGCGCTCAATTTAGGATCGGAGAAGAAGCTGAAGGAAAACGTGAAACGCGTTCACTGTTG
TATCGATAAGATCATAGAGGAAAAGAAACAGAAGATCGTTAGTGGTAATCACATGGATCT
TCTGTCTAGATTATTACTTGCAGGACACGAAAATGAAGTGGTGAGAGATATGGTCATAAG
TTTTCTAATAGCAGGAAGAGACACCACTTCTTCCGCATTGACGTGGCTTTTTGGCTCACT
ACCAATCACCATGACATCAAAGACAAAATGATCAAAGAAATAACGTCGATCAACAATGGT
GATCATAAGGAGCTTGAATTTGATGAATTAAAAGAGATGAAGTATTTAGCTGCGTGCTTG
AATGAATCAATGAGGCTTTATCCGCCAGTGGCTTGGGATTCTAAGCACGCGGCTAAAGAC
GACATATTACCAGGCGGAACAAGGGTTCAAAAGGGTAATAGAGTTACTTATTTCCAGTAT
GGAATGGGTCGGATGGAGGAGATTTGGGGAAAAGACCGACTCGAATTCAAACCGGAACGT
TGGATGGATGAAAATGGAGAGTTGAAAATTGTGAGTCCGTATAAGTATCCAGTGTTTCAA
GCAGGTCCAAGGGTGTGTTTGGGGAAAGAAATGGCATTTACGCAGATGAAGTATGTGTTG
GCTTCGGTTCTTAGGCGGTTTGAGATTAAACCGGTAAAGGTAGAAAAACCGGTTTTTGTG
CCTCTTTTAACCGCTCACATGGTTGGAGGATTTAATGTAAGAATCCATCACCGTGATGGC
TAGCTTGGCTAAAAGGTTGTTCAATTAGCATTTGCTGCTTGTTATATCTTTTGCAAATGA
AAAATATCAATGAAGATGTATATTTTATGAATATGTAGCTTGAAATTTACTTGTGTTGTT
GTAAAATCTTAATGAAGGAAATTAGGAATGATAAACTATTTCATATGGTAAAA