Microarray Probes on PGSC0003DMT400039234

Probe IDChipProbe Sequence
CUST_22490_PI426222305 JHI_St_60k_v1 CCCAAGTTTCTACTTCGATTGGTGCACATGACATATGTTGAATTAATGACTACGATTTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400039234

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400039234 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G23180.1 +3 5e-132 258 128/246 (52%) cysteine-rich RLK (RECEPTOR-like protein kinase) 10 | chr4:12138171-12140780 FORWARD LENGTH=669

Transcript Sequence (2695 bp)

>PGSC0003DMT400039234 2695 pgsc_dm_v3.4
AAAATAAAAATATTAGCATTGTATATTATTCAATATATTCCACATTTTATTAACATGTAT
TATTATTTTGTAAATAATATATATTAATAATTTACTACAAGTTTAATATAATAGTTAATA
ATTCATGTATTGTAATCTCTACATAACTAATATCCACATAGCTAATACCCGCATAATTAA
ACCCTGCATAACTAAACCCTGCATAATTAATACCTGCATAACTAAACCCTGTATAACTAA
TACCTGCATAACTCTAACCAGTAACCAAACGGCCCCTTATTGCTTCTATCCCCAGTACTG
TTACTTTCCGTCTCGACTCCTTAGACCAATTCTTCCTTGAAGTTAATGTTTTGTGGGAAA
AAAACTTCATCAAAATTGTTTTTTCATGATCAGACTGTTGACTTCGTCGTCCTTGTAGTT
TTGAGCAGATTCATCTTCTGCTCCATCATTTAGATTACTTTAGACATAATTCAGCAGCAA
CTTATTTTAGTCAAGAATGGCGTTGGTTATAGTTTTGTGTTTGTGCAGTATCCAAACAAT
TCTGATTTTGTTGCTCCATTCACTGCTTGTGGGCGTCAAAGCACAGATGCAGCCCTCATA
CTACACTTGTTCAATGATCAATAATTATACAGAAGGAAGCATATTCCAATCAAATCTTAA
CCAATTGCTGTACAGTCCATTAAACAATAATGGTAACAATTCCATCTATACAAAAGCCAG
AGAAGGAGAAGACCCTGATAAAGTTTATGGAGTATTCCTCTGTAGAGGAGACGTTGTACC
TAATGACTGCAAAAACTGCATTGACGTGGCAAGAGAGCGGATCCAACGTGAATGTCCGCT
CAAGAAGCAGGCAATTATATGGTTTGATGAGTGATTGGTCCGCTATTCTAATGTATCTTT
CGTGTCCATGTTAGACACCTCGATTTCTAAGATCCTGTATAGCGTAGAAAATGTTTCACA
GCCAGAACAATTTATGGGGAATTTGAGTGCAATGTTTGATAATCTTACCGCTCAAGCTAC
TACAATCAATCTCAATCTGAAATATGCTGACAATTCTGATGTAATTAACTCGTTTGATGG
CAAATTGCATGCATCAGTGCAGTGTCTACCTGATTTGTCAGCTGTAAATTGTGTCACTTG
CCTGAAAACTGCTTTTTCTGGAATCCGTAACCTCTCTCTGTCTATTGCCAAGGTACCACG
TGGAGTCAGAATACTACTTCCTAGCTGCAATTTAAGGTATGAGCTATATCCATTCCTCTA
TGCCAGTGTACCGCCATCGACCAGACAGGGGAATGAAGACGAAGGCAAAAATACTTCAAA
GACAAAGCTTATAAGTATCATTATAGGTGTTATACTAGCAATTTTAGCTGTTGTACTGGC
AGGGAGGAATGAAAAGAGTCGAGAAATTCAATTGCTTGACATGATAGGAGAAACGCTTGA
TGCGAATGATGATTTTGGCTCAGAAAAGCAGGGGAGATCCAGAGAATTTCCAGTAGTAAA
ACTAGACCTCATTCGAGCTGCTACACAAAAATTTTCTGAAGAAAACAAGCTTGGAGAAGG
TGGATTTGGTCCAGTGTACAAGGGTACTCTAGCCAATGGCATAGCAATTGCAATCAAGAG
GCTCTCTAGAACGTCCGGTCAGGGACTGAAAGAGTTCAAGAATGAAGTTGTCTTAATTGC
CAGATTACAACACAGAAATCTCGTGAGGCTCTTGGGTTGCTGTTTAGAGGGAAATGAGGC
ACTGCTTATCTATGAGTTCATGCCCAACAAAATCCTGGACTTCTTCCTTTTTGGTTTGAC
GTTCACTTATTTGGCATATTAGTATATGCCACAAAGAAGCAATTAATTCACTAACTTCAA
ACTTTCTTTTTCTAGATTCAAGAGAAAATGAAATTCTGGAATGGAGACAACGTGTCCACA
TTATTAAAGGAATAGCAAAGGGTATTTTGTATCTACACGAGGATTCTCGACTAAGAATCA
TTCATAGGGACCTAAAAGCTAGCAATATTTTACTGGACAAAGATATGAACCCCAAGATAT
CTGACTTTGGAATGGCAAAGATGTTTAGCGGAAATCAACGAGAAGCCAATACAAATAGAG
TTATTGGAACCTATGGATATATGGCCCCTGAGTATGCTATGGAGGGACTTTTTTCTACTA
AATCAGATGTTTTCAGCTTTGGTGTTCTGTTGCTTGAGATAGTAAGTGGAAGGAAGAACA
ATAGCTATGTTTCCGAATATGGTCAGAGTCTCCTTAATTTTGCGTGGAAGTTGTGGTGTG
AAGAGCATGGATTAGAGCTAATGGACCCTTGCTTATCACAGTCTTGTGTGACAACTGAGA
TAACAAAATGCATCCATATCGGACTACTCTGCGTTCAACAAGATCCAGCAGATAGACCTA
CCATGTCCTCTGTGGTTTTTATGCTGGAAAACGACACTAAAACATTTCCACAACCATCAC
AACCTGCATTTTCTATTGGGAGACTTGCCGTGAGATCAGCTGAGCCTCGATCTAATGATC
AGTTATGTTCCGTTAACGAGGTCACTTTATCAATTCTATCACCCCGATGACCATTAATAT
AGGGTCCATCAAGGATCTGTCTCCTCTCCATTTTCCCCAAGTTTCTACTTCGATTGGTGC
ACATGACATATGTTGAATTAATGACTACGATTTAATTGACCAAAATAAATCCCTA