Microarray Probes on PGSC0003DMT400039185

Probe IDChipProbe Sequence
CUST_22457_PI426222305 JHI_St_60k_v1 CCTTGTTTGGATGGTTGTTACCTATTGTACGTACGGTATTGTATTGTGTTGTTAGTTTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400039185

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400039185 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G48310.1 +1 3e-165 481 241/463 (52%) cytochrome P450, family 71, subfamily A, polypeptide 22 | chr3:17888192-17889749 FORWARD LENGTH=490

Transcript Sequence (1496 bp)

>PGSC0003DMT400039185 1496 pgsc_dm_v3.4
CACAAACTAGGTGTGTATCCTCACCACTCTTTACACAAATTAGCTCAACAATATGGACCT
TTGATGTTCCTTAAACTCGGGAGCGTAAATACTCTTGTTGTTTCCTCAGCTGAAGCAGCT
TCCGAGATCATGAAAACACATGACCTTGTTTTTTGCGACAGGCCTAAATCCAATGTCAAC
AAGAAACTTTTGTACGACTTTAAGGATGTGTCTGTCGCGCCTTATGGTGAGTACTGGAGA
CAAATGCGAAGTATATGTGTACTACAATTGCTTAGTACAAAAAGGGTTCAAGGTTTTCGC
GTTGTGAGGGAAGAAGAGACTGCCTTGTTAGTCAAGAAAATTAAGGAGAGGTCACCAGAG
GCAGTGGATTTGAGTGAATTGTTTATGACACTTACAAATGATATTGTGAGTAGAGCAGCT
TTTGGGAGGAAATATAGTGGAGGGGAGAGTGGAGAGAAGTTTAGGAAGTTGATGAAGGAA
TTTGTGGGGATATTAGGTGGATTTGATTTTGGGACTTTTTTACCCTCACTTGCATGGATT
GATAGAGTTAGTGGTTTAGAAGCAAAAGTGGATAGAGTTGCTAAGGAGATGGATGAGTTT
CTTGAAGGAGTAGTGGAAGAACATTTAGATAGTCATAAAAGAGTGAAGGAATTGTTGGGG
GACAAAGTGGAAAATGAAAATAGAGAGGACTTTGTTGATGTTTTGCTTGGGATTTACAAA
CAAAACATGGTGGATGGCTTTTCTATTGACAGAGATGGCATCAAAGCTCTCATTGTGGAC
ATATTTGCGGGTGGAACAGATACAACTTACACTGTGTTAGAATGGGCCATGACAGAGCTT
CTAAGGCATCCTGGAGCAATGAACAAACTCCAAAACGAAGCCAGGGAAATAACTAAAGCG
AAAAATGAAACTTTATCTGAGGATGACTTGGACAAAATGCATTATTTAAAAGCAGTAATT
AAGGAAACATTGCGATTACATCCTCCGATTCCTCTGTTAGTTCCTCGACAAGCTAGACAA
GATGTTAAGGTGATGGGGTACGATGTTGCTGCTGGTACAATGGTTATAACGAATGGATGG
GCGATTGGAAGGGATCCTGAAATTTGGGATGATGCAGAGGAGTTTAAGCCGGAGAGATTC
TTGAATTCTTCGATTGATTTTAAAGGACATGATTTTGGATTGATACCTTTTGGTGCAGGA
AGAAGAGGATGTCCTGGAATTTCATTTGCAATGGCTACTAATGAGCTTGTACTAGCTAAT
GTTGTTAGGGAATTTGATTGGAAATTGCCAAATGGAGCAAAAGGGGATGATTTAGATATG
ACAGAATGTACTGGTTTAACTATTCACAGGAAAGTTCCTCTGTTTGCTGTTGCAACTTCA
AACACCGCCTAGTTTTTTTTTTTGGTTTTTCACTCGCACCTTGTTTGGATGGTTGTTACC
TATTGTACGTACGGTATTGTATTGTGTTGTTAGTTTAAATATGATGTTTGTTTTGA