Microarray Probes on PGSC0003DMT400038659

Probe IDChipProbe Sequence
CUST_44168_PI426222305 JHI_St_60k_v1 CCGGTTGTATGTCACTTTTGGCTAAGTGGGCCTAAAATAAAGCATAGTATAGTAATAATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400038659

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400038659 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G05300.1 +1 1e-110 333 176/359 (49%) zinc transporter 5 precursor | chr1:1545258-1547709 REVERSE LENGTH=360

Transcript Sequence (1242 bp)

>PGSC0003DMT400038659 1242 pgsc_dm_v3.4
AAAACTTCCCTCTTCTCTATCAACATGAAGAATAAACGTGTTGCTTTTTCTCTTCTCTTT
TTGACGTTCTTTCTTCCTGCTTTAGTTTCTTCAGAATGTACTTGCGATGAAGATGCCGAT
GATCGGAACAGAATCGAAGCGTTGAAGTATAAATTGGTAGCAGTCGCTTCGATTTTAATT
GCCGGTGCTATAGGCGTATCGATTCCAATTCTCGGTAAAATAATCCCAGCTTTTCGCCCC
GAAAACAATGTGTTTGTCCTAATTAAGGCTTTTGCGGCCGGAGTGATTTTGGCTACCGGA
TTTGTTCATATACTTCCGGATGCATTCGAGAGCTTGTCTAGTCCTTGTCTTCCGGAAAAA
CCATGGGGAGATTTTCCCTTTGCTGGACTTATTGCTATGATTTCCGCTATCGGAACGATG
ATGGTGGATTTATTGGCGACCAGTTTTTATAAGAAATCGAATCTTACGAAACAAAAGCCT
GTGAATAGTGATGAAGAAAAAGAGGTACATGTGCATACGCATTCAACTCATGGACATGCT
CATGGCTCTGTTATGTTGTCGTCATCGGAGGGTACCGATGAATTGGATTTATCTCGTCGG
AGAGTTATCTCACAGGTATTGGAATTGGGAATTTTGGTGCATTCAGTAATAATTGGTGTT
TCTTTAGGTGCCTCAGAATCTCCTAAGACAATTAAGCCCCTTGTAGCTGCATTAACTTTC
CATCAACTGTTTGAAGGCATGGGTTTAGGTGGCTGCATAGCTGAGGCGAAATTCAAGATT
AAAAAAGCTGCATTGATGTCAATTTTCTTCTCCCTAACAACACCAATTGGAATTGCAATT
GGTTTTGGAATATCAACAGTGTATAGTGAAACAAGTCCAACTGCACTCATGGTTGAAGGC
ATTTTCAATTCTGCTGCTGCTGGAATTTTGATTTACATGGCTTTAGTGGATTTACTTGCA
GCAGATTTTATGAGCACTAGAATGCAAGATAGTCCTAAACTTTTGATGGGAGCTAATATA
TTTCTTCTTTTTGGGGCCGGTTGTATGTCACTTTTGGCTAAGTGGGCCTAAAATAAAGCA
TAGTATAGTAATAATTTCATCATTTTTGTAATCTTGATTAATTCATACCCATGATTAAAT
ATGGGACAAAATTAATCTTAATCTTAAAGGTTCTTTATTTTTGCTTTAAAGAATAAAGAA
TGTTGGAATTATATAGAGAAATTGATGTTTTTAGAGGATGTG