Microarray Probes on PGSC0003DMT400038577

Probe IDChipProbe Sequence
CUST_5104_PI426222305 JHI_St_60k_v1 GTATGTCCAGCGTACCAAACGACCCTTAGAACTATATATGTATATATGTGTATGGTAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400038577

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400038577 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G50660.1 +3 4e-25 105 45/60 (75%) Cytochrome P450 superfamily protein | chr3:18814262-18817168 REVERSE LENGTH=513

Transcript Sequence (913 bp)

>PGSC0003DMT400038577 913 pgsc_dm_v3.4
GAATTTTTTGTCTCGGGACTAACTATATATGCATGTATGTCCAGCGTACCAAACGACCCT
TAGAACTATATATGTATATATGTGTATGGTAAAATTTAGAAGTGATGAATAGTGCGTTAA
TGCAGAATGCAGAAGAGTCGCCTTCAGGTAAAGGAGGAAGCACAGGCACAAGCAGCACAA
CAAAAAGTAGTAATAATTTCATGCCATTTGGGGGAGGTCCACGTCTATGTGCAGGATCTG
AACTGGCCAAACTTGAGATGGCCATTTTCATTCACTATCTTGTTCTTAATTTTCACTGGA
AATTAGCTGCACCTGATCAGGCTTTTGCCTATCCTTACGTAGATTTTCCCAATGCCCTAC
CTATCACTATCCAACATCGATCCTCAACTAAATTGCATGACTAGTCCTAATTCATCGTAT
TAAAACTGCGTTCGCGCGTCGTCTATGGGTAAACATTATATTATATTGTATAAATAAAAA
ATAGTAGCTGAACAAATGGGAAAGAGGATGGTACTTGAAATGGTTCAATCCAAAGAGATG
TTTTGTAAATCTAGCTATTTATTATCTAGGAGGTGAAGCAGCTGCTACAGTTTTTGTTCT
CTTTTTTTGTTGCTTAATCTCTTCTCTTGTTTCCTTTTTTTTTTTTCTCTATGTTACGTA
GTACATAATTTTCTATGTAATTAAATACAGCAAGTTATTCGATTCCCCTTAAGTAATCGC
GGGTGTAAACTTTAAATATGGGAAGGGTGATTTGCACAAATATGATATTTCCATGCCATC
TTTTAAATGTCGCCCATGTTAAGAGAAGTGTTGGAAAAATAGCCTTCGCTCCAAAATTTG
GAAGCACGCTCTTGGCACAATTATCAAGAGTTTTTATTTGAAATTCGATCAAGATTTCAC
TTAACAGTACCAG