Microarray Probes on PGSC0003DMT400038535

Probe IDChipProbe Sequence
CUST_9783_PI426222305 JHI_St_60k_v1 CTTTAATTTCTGCATTGGATAATAGGCAAATGCCTCTTGACAATGCATCTGTATTGATAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400038535

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400038535 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G24010.1 +2 0.0 570 366/821 (45%) Protein kinase superfamily protein | chr5:8113910-8116384 FORWARD LENGTH=824

Transcript Sequence (2705 bp)

>PGSC0003DMT400038535 2705 pgsc_dm_v3.4
TATTACTTCAACTGCATTCTGCCAAAAACATTAATGGTATTCTCCATCCACCATGACTAT
TCTCCTCTCATTTCTCACTTTTTCTCTTCTCTTCCTCCCATTTTCCATTTCCTCATCAAC
TGATTACACCTTCCCTGAGAAACACTTCATCAATTGTGGTTCTGATTCTCCCATCGTACT
CAACCGCGGCGGCGGCAGCACCACTTTTGCCGGCGACTTGAACTTCGACCCCAACCACAG
TGACTCCGTTAAAGACCACACCACTACTACAGGTTTAGCTGGAATCTATCAAACCGCCAG
AAAGTTCACTAAATCTGGGTCATATAATCTTCCAATTGATGAAAATGGGGTTTACATGGT
ACGGCTTCATTTCTTTCCTTTCGTTTCTCTATTCGATGCGGAATTCAGTGTTTCCGCTTC
TGGGTTTTTGCTATTGTCCAATTTTAGCATACCTAGAAACTTAATAACTTCCCCTGTTAT
CAAAGAGTTTCTGGTTCCTGTACTAAAAGGTCGTAATTTGGAAATCATTTTCAGATCTGA
TTCTTCTTTTGCATTTGTTAATGCAATAGAAGCATTTGTTACTCCTCAAGGTTTCATTCC
TAACTCTAATGACACAACCCATGTCACTAGCAGCAAAAATGATTTATCCTCGAGTGTTTT
GAATGTTATTCATAGGATTAATGTTGGGGGTTCTAATATTACCGACGATACGGATACCAT
GAGGAGAAAATGGGTAGCTGATGATGATTACTTACTTATCAAAAGATTTGCTAAGAACCT
TCCAATGTATAGTGGTAGTCTTAACTATGATCAAGTAAGAGGGGCTACTCCGTATGATGC
TCCTGATTTGGTTTATAAAACTGCCAAAGAAATGAATAGTAATCATACTGAGACTCAAAG
TAACATAACTTGGCGTTTAGAGGTGAAAAGGAATGCTACATTTTTTGTACGTCTACACTT
TTGTGACATTGTTAGTGTTCAGCGGAATGGTACAGTTTTCAATGCCTATATATATGGTCA
GTTTGGTAAGCCAATTAGTCCATATGATAGATTTGAAAAATTTGCAGTTCCTTTTTATGT
TGATTTTGTGGTGGATTCAGATGGTTCTGGTTTTATGAATATCTCAGTTGGTCCTCGGAA
TGATTCAAAGTCTATAAATGCTTTTTTGAATGGGGTGGAAATAATGGAGTTGATTAATGA
TCGGGTTGAGTGGAGTGGAGAAAAGAATAACAATGTTTGGATAATTGTTGGTTCTGTTGT
TGGTGGTGTGGTTCTCATTTCTGTTTCTATTGTGGTGATCTTGTGTTGTTTGAAACCAAG
AAAAGCACAAACGGTTGAGAACTCGAGTTGGTGGCCAAGGATGAGTGTTAATGCTGGAAG
TACAGAGGATAGGACTACTGTAAGAACTCCAATTGGTAGCACTACTCCTGATATGAACCT
TGGGTTAAAGATATCTTTCGCGGAGATTTTGCATGCTACTAATAAGTTTGATCCCAAATT
TATGATTGGTGAGGGTGGTTTTGGGAAAGTTTACAAAGGAACTTTACACAGTGGTGTTAA
AGTGGCTGTGAAAAGAAGCGAAGCTGGACATGGGCAGGGTCTTATGGAATTTCAAACTGA
GATAATGCTCTTGTCCAAAATCCGCCATCAACATCTTGTTTCATTGATTGGTTATTGTGA
TGAACGAGATGAGATGATACTTGTTTATGAATTCATGGCGAAGGGAACTTTGAGAGAGCA
TTTGTACAGTTCGAATGAAGATCTTGGTAAATCATCTTCACGGTCAAAATTATCGTGGGA
TCAAAGGCTTCAAATTTGTATAGGTGCAGCTAATGGTCTACAGTACCTTCATGCCGGTTT
ACCTGAGCCAACTATTCACAGGGATATTAAGTCAACAAACATACTTCTTGATGAAGATTA
TGTTGCCAAAGTTGCTGATTTCGGTCTCTCCAAATCAGGTCAACCTGAAGAAACACACAT
TGTTACTGATGTTAAAGGTAGCTTCGGTTATCTTGATCCCGAGTACCTGAAATCAATGCA
ACTAACTCAAAAGTCTGATGTCTATTCTTTTGGAGTTGTACTTTTTGAAGTACTTTGTGC
TAGACCAGCTGTTGATAATATGCTTCCAAGAAATCAAATGAACTTAGCTGAATGGGGACT
TTCTTGGCTAAAAGAAAACCAGATCGAAAAGATAATTGATCCATTTCTTGTAGGTAAAAT
TAACCCAAACTCTCTGAGGAAATTCGGAGAAACAGCAGAGAAGTGTCTGCAAGAGAATGG
CACTGATAGGCCTAAGATGATGGATGTGTTGTGGGACTTGGATTACGCTCGACAGCTTCA
ACACCCTACAATGCCCCAACAATCTCATGAGGATACCAACTCCGATGTTTCGTGGCAAAT
GGCATTGCCTGGTATCAATCGCTTACCTTCTATAAATGTAAGCACAAGCTTTGTCAGTGT
CACTGATAGCGAGGCTTTTTCAGAATTGAGGATCGATGAAACCAGATGATTTGTGGCCTC
GTTGTTGTTAGCATTCCATCTTATTCTACTTCATTCTGTCTAATGTAATTGTGTATCAAA
ACAGTGTGTAATAGTCAGTGTTCAGCTTTAATTTCTGCATTGGATAATAGGCAAATGCCT
CTTGACAATGCATCTGTATTGATAGTATATAATATTCATAATAAAGTCTCGTGTCTATTC
TCCCA