Microarray Probes on PGSC0003DMT400038501

Probe IDChipProbe Sequence
CUST_9776_PI426222305 JHI_St_60k_v1 GACCATGCCAATGCCCTGCTAAATCAAGGCTATGTTTAATTTCTTTTAGGATTTGAATTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400038501

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400038501 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G20340.1 +1 0.0 577 269/490 (55%) Pyridoxal phosphate (PLP)-dependent transferases superfamily protein | chr2:8779804-8782490 FORWARD LENGTH=490

Transcript Sequence (1829 bp)

>PGSC0003DMT400038501 1829 pgsc_dm_v3.4
CAATAGTTTAGTTCATTTTTAACCTTATAAAAGCTAACCATTTATTTTTCTTTCAAGACA
ACATACACACAAATTGAAATAATGGGTACCCTCAACATCAACCATGAACTTGATGACCAA
ATTTTCAATACCATAAACCCTTTAGACCCTGAAGAATTTAGAAGGCAAGGTCACAAAATT
GTGAATTTCTTAGCTGATTACTATCAAAACATTGAACAATATCCTGTTTGTAGTCAAGTA
AATCCAGGGTATCTCCAAAAAATTGTACCAAATTCCGCACCTAATAACTCTGAGTCACTC
GAAAAAATTCTTAAGGATGTTGAAAGGGATATTATTCCAGGGCTAACACATTGGCAAAGT
CCTAATTTTTTCGCGTATTTTCCATCTTCAGGAAGTACTGCTGGATTCCTAGGTGAAATG
TTAAGTGTTGGATTTAATGTTGTAGGGTTTAATTGGATATCATCCCCTGCTGCTACTGAA
CTTGAGAGTATTGTGATGGATTGGTTTGGGAAAATGTTAAATCTTCCCAATTGTTTTTTG
TTTGCGAGTGGTGGTGGAGGTGTACTACAAGGTACAACTTGTGAAGCCATGTTGTGCACT
ATAGTCGCGGCTAGAGATCAAATGTTGCGAAAAATAAGTAGAGAGAATTTTGGCAAATTG
GTGGTATATGCATCTGATCAAACACATTTTTCACTTAAGAAGGCTGCCCACATTGCTGGG
ATAGACCCTGGAAATTTCCGAGTTATCCCAACAATAAAGGCTAATGAGTACACCTTGTGT
CCAAAATCGCTACGTTTAGCAATTTTGAATGACCTTAAAGAAGGAAATGTTCCTTTATTC
TTGTGCGCGACAATTGGGACAACTGCAACAACTTCTGTTGATCCATTGCGTTTACTCTGT
GAAATTGCTAAGGAATTTGGGATTTGGGTACATGTAGATGCAGCTTATGCAGGAAGTGCT
TGTATTTGCCCTGAATTTCAGGTCTTTCTTGATGGTGTTGAAAATGCAAATTCTTTTAGT
CTCAACGCGCACAAATGGTTCTTTTCCACTTTGGATTGTTGTTGCCTTTGGGTTAAGGAT
CCAAGTGCACTTACAAACGCGTTATCAACTAATCCTGAATGTTTGAGAAACAAGGCTACA
GAGTTAAATCAAGTGATTGATTATAAGGATTGGCAAATTGCATTGAGTAAGAGGTTTAGA
GCATTGAAGTTATGGTTAGTTTTGAGAAGTTATGGGGTAACTAATCTTAGAAACTTGATA
AGAAGTCATGTGAACATGGCTAAACATTTTGAAGGACTTGTAGCTACGGACAAAAGGTTT
GAAATCTTTGTCCCTAGAAAGTTTGCTATGGTTTGTTTTAGGATCTCCCCATTAGTACTA
AGTCAAGTTTCAACCAAATTTGATGATGAGAAAGAAGTGAACATGTTTAACACTAAGTTG
GTGGAGTCTATTAATTCATGTGGCAAACTCTATTTGACTCATGGAGTTGTTGGAGGCACT
TATATTATTAGATTTGCAATTGGTGCTTCTCTTACACATTATAGGCATGTTGACGTAGCT
TGGAAAGTTATACAAGACCATGCCAATGCCCTGCTAAATCAAGGCTATGTTTAATTTCTT
TTAGGATTTGAATTATATATGTACTGAAAGATTTTTATACTGTCAACGTTTAGTTATTTA
TTCAAAAACTAGGGGAATCTTAGTAGGTCAGTTAGTTGACTATCTGAATTATTATCTTGT
TCATGAAAGTTCAATTTCTCACCTTGTAATCCTCATTTCCAATTTTCCTTGCCCTATCCA
ATTTAAAAGGAAAAATTTGTATTCAAAAC