Microarray Probes on PGSC0003DMT400038220

Probe IDChipProbe Sequence
CUST_42200_PI426222305 JHI_St_60k_v1 GATCGTAGTTGGGAAATGTTACTTGCAAAGTTACCAATATGTTGAGAGATATGGTTTAGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400038220

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400038220 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G74190.1 +3 9e-24 100 72/178 (40%) receptor like protein 15 | chr1:27902590-27906158 REVERSE LENGTH=965

Transcript Sequence (608 bp)

>PGSC0003DMT400038220 608 pgsc_dm_v3.4
TGTACCAGTATGACACAATTTTGGCGTTGTTTACAAGTATGGATATGTCTAGCAATAATC
TTTCTGGAGATATTCCTACAAGTCTAACACGTCTTGCAGGATTAAGATCATTTAATCTTT
CCAAAAATAACCTAACTGGTAGGATTCCAAATGACATTGGTGACATGAAAGTCTTGGAAT
CTGTTGATCTTTCAGAAAATCAACTTTACGATCAAATCCCACAAAGTTTTTCGAGTTTGT
CTACATTGAGCTACTTGAATCTATCTGATAACAATTTGTCAGGTATGATACCATTGAGCA
CTCAACTTCAAAGCTTTAATTCCACAAGTTTTCAAGGAAACAAACTCTGCGGACTTCCAC
TCTTGGTGAACTGCAGTTCAGATGACAATATTCCAAATCACGAATATGAAGTTGATGAGA
GTGACAAAGATGAAGTGGATTGGTTTTACATTTCAATGGCTATTGGATTCGCACTAAGCT
TTTGGGGTGTTTGTGGTTCATTGCTTTTCAAGAGATCATGGAGACATGCTTATTTTCGTT
TTCTAGATCGTAGTTGGGAAATGTTACTTGCAAAGTTACCAATATGTTGAGAGATATGGT
TTAGGATA