Microarray Probes on PGSC0003DMT400038146

Probe IDChipProbe Sequence
CUST_45997_PI426222305 JHI_St_60k_v1 GAGATCTTGTTATTATTCCAAAAGGATTAAGTTGCACTTGGGATGTTTCAATTGCTGTTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400038146

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400038146 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G28703.1 +1 3e-42 139 68/103 (66%) RmlC-like cupins superfamily protein | chr4:14166365-14166798 FORWARD LENGTH=107

Transcript Sequence (474 bp)

>PGSC0003DMT400038146 474 pgsc_dm_v3.4
AAAGGGTGAAGTTGAACTTGAGTGCATATATATATATAAATAAATATCTCTTTTAATTTA
TTTTTCTTTTCTTTCATGGCTTCTTCTTCTTCATCATCATCAAATCTTGGGATAATTGTT
CAAAAGAATCCTTCACAATCTCAACTCGATGAATTGGGCATCAAATCTTGGCCTAAATGG
GGTTGTTCTCCAGGAAAATACCAATTAAAATTTGATGCACAAGAGACATGTTATTTATTG
AGAGGTAAAGTGAAAGTTTCAACAAAGAATTCAAATGATGAAATAGTTGAATTTGGAGCT
GGAGATCTTGTTATTATTCCAAAAGGATTAAGTTGCACTTGGGATGTTTCAATTGCTGTT
GATAAACACTATAAGTTTGATTCATCTTAATTAGTTCTTCTTAATCCTCATTAAAAACTT
AGCTAATTTTCTTGTTTATGATAAACATCTCATGTTGATTGTAATCAATTTTCT