Microarray Probes on PGSC0003DMT400037950

Probe IDChipProbe Sequence
CUST_30837_PI426222305 JHI_St_60k_v1 TGTGTATACTCTACACCCCTCATTGAATATGTTGTTGTTGTTGTGGATAAACTGACCTCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400037950

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400037950 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G20560.1 +1 0.0 806 377/549 (69%) acyl activating enzyme 1 | chr1:7119927-7121730 REVERSE LENGTH=556

Transcript Sequence (2043 bp)

>PGSC0003DMT400037950 2043 pgsc_dm_v3.4
ATACGCAGTACGCACCATAGATTAAAATAATAATTACTCCATTTGTCTGTGATTTTTCTC
TCTTCTTCTTCTTCTTGAGTGCTCTCAATTTGAAATTTGAAAATGGAGGGGACGATTAGA
TGCTCTGCAAATTACGTTCCGTTGAGTCCAATAAGCTTTTTGTTAAGATCAGGTGTGGTA
TACAGCAACAGAATTTCTATTGTTTATGGCGATGTTAAGTTTACTTGGGCGGAGACAAGA
CGAAGGTGTTTACAACTTGCTTCTGCTTTTACCCATTTTGGGATTTCTCGGGGCGATGTC
GTTGCTGTTTTGGCTCCAAATATTCCTGCAATATATGAGCTACACTTTGCGGTACCAATG
GCTGGGGCAGTTCTTTGTACTCTCAATGTTCGTCATGATTCAGCAATGGTCTCGGTTTTA
CTCAAACATTCAGAGGCAAAAGTCATACTTGTAGATTACCAGTTCCTTGATGTTGCTAAC
GGGGCGTTACAGATTCTTTCGAAGGAAAATATTAAATTGCCTCATCTAATCCTAATCCCC
GACTGTGACAAACGCTCATCGAATTCTCATATTATGGAATACGAGGCCTTTTTAGCTACG
GGAAGGCCTAATTTTGAGGTAGTATGGCCAAATGATGAGTGGGATCCCATTTCCCTGAAT
TATACTTCAGGTACAACGTCGAGTCCAAAGGGTGTCGTCTATAGTCATAGAGGAGCATAT
CTTAATTCTCTGTCAGCTGTTCTTCTCAATGAAATGCCTTCAATGCCCGTCTACTTATGG
ACAGTTCCGATGTTTCATTGCAACGGATGGTGCCTTACATGGGCCGTGGCAGCACAGGGT
GGCACGAATATTTGTCTTAGGAATGTTACTGCTGAAGGAATTTTTACAAGCATAGATAGG
CACCAAGTGAGTCACATGGGTGGTGCACCTACAGTTTTAAACATGATAATACACGCACCT
CCTAGTATCCGTAGGCCACTTCCAAGGAAAGTAGCAGTGATGACCGGCGGTGCACCACCT
CCTCCTCAAGTTTTATTTATGATGGATGAACTTGGTTTTAATGTTACTCACTCATATGGT
CTAACGGAAACATATGGTCCTGGAACTGTTTGCACTTGGAAACCTGAATGGAGTTCTCTG
TCACGTGATGAGCAGGCGAAAATCAAGGCTCGTCAAGGGTTGCATCATATTGGTATGGAG
GAAGTAGATGTGAAGGATCCAGCTTCAATGAAGAGCGTATCACCCGATGCAAAAACAATG
GGTGAGGTAATGTTTAGAGGAAATGTTGTAATGAATGGGTACTTGAAGAATGCCAAAGCA
ACAGAAGAAGCTTTTAAAGGGGGTTGGTTTCGAACTGGGGACTTGGCTGTGAAGCACCCC
GATGGTTACATCGAATTGAAGGATCGTGCTAAGGACATCATTATATCTGGTGGAGAAAAC
ATTAGTACAATTGAGGTGGAATCAGTACTATTCAGCCATCCATCTGTTCTCGACGCTGCT
GTAGTAGGAAGACCAGATGATTACTGGGGTGAGACATCTTGTGCCTTTGTGAAACTAAAG
GAGGGTAACAATGCAACTATGGATGAAATCATCAAGTATTGTCGTGATCGTTTACCACAT
TACATGGCTCCGAAAACAGTAATTTTCGATGATTTGCCCAAAACATCTACAGGAAAGACA
CAAAAATTTGTTTTGAGACAGAGGGCCAAAGCTATGGGGAGTATTACAAAGGCAGCTAGC
AAATTATAATTTGTAATTTCCTGTGTTGTATTGTGGATAGACTGATAAAAAGTCTGGCAG
GCAAGTTGAGGGTCGATCAGAAACAACCTCTCTATCTCTACGAGGTAGGGGTAAGTTCTG
TGTATACTCTACACCCCTCATTGAATATGTTGTTGTTGTTGTGGATAAACTGACCTCTGT
TTTATTTTATAAAATCACATTTATGTTGTGGGAATGCCTCATTAGTGTATATGATAATTT
ACTAATGTTGGTTAGTAATATGTATGGTAACAATGGTGAATGATAACGATGGTTGACTAT
ATA