Microarray Probes on PGSC0003DMT400037857

Probe IDChipProbe Sequence
CUST_38923_PI426222305 JHI_St_60k_v1 AACGGTGAAGCTTGAGTACTCCTGGTGTGTAATTTTGTTCTTGACAGATGTGGGAGGTAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400037857

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400037857 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G37710.1 +2 6e-34 132 75/152 (49%) alpha/beta-Hydrolases superfamily protein | chr5:14979159-14981400 FORWARD LENGTH=436

Transcript Sequence (1298 bp)

>PGSC0003DMT400037857 1298 pgsc_dm_v3.4
CCTTTAATTTAAACATAATAAATCTGATTATACTCTCCTGTTCTTCTCCCTAAAGTGCAA
CATGAGTTGGTTTCAAGTGGGGGCAATAAGAACCTTAAGCAGTAAGAATAGATTCTTGGT
TCAGTTATCTCTCGTCCAGGATCTAGCTACCTAACAAATTTTCCTGCTTGTATGTTGTGT
ATTCACCATGTCTTCTGATTCTATTGTATATTCTCTTCACATAACTGTCAGCACAATATC
CGAACATGCTTAGGCATGTACAATTGTTGTACACATGCTGCTATGGCAAAGTATATTCAA
ATTAGACCATGGTATTTCCCCACTGTTCCGGATTTCATTATCAGTAAATAAAAAAATGTT
TCCCTAACAAGTAGAACTTTTTAATTCACCGACTTCTTGGATGTGATTGTAGCTCTAAAT
CTTCGCTTCATTTTTGTTATGATATTTCGACAACGGTGAAGCTTGAGTACTCCTGGTGTG
TAATTTTGTTCTTGACAGATGTGGGAGGTACCCTCCAGATGTTAGAACTGCAATCCCCGT
TGACGGAAGATTTGAACAGATTGTGTTGTCATGCAACTCTCTATACGATCATGGGATCAT
TTCGATAGAAAAAGAATCTGAAAAGGCATTTGCAAGACTTAAAGAGGCTAGTGCGGAGAC
CACCACTTCTCCCCCTAAAGTGCAGAGAATTGAAAGACTGAAGACATTAGAAAAAGAGCA
CAAGGATGCAATCGAAAGAGCCGTCAGTTTAAATATACCACACGCTGTGGGTGTAGGGGA
AGAGGAATCCTCAACACAAAAAGAGGAAGAACCCATGGAGGATATAACTTTTGAGGCATC
TCAAAAACACGATGAAGATGCATCCACAAGCGAAGCCCAGGGAAGTGATGGAAGAACTAA
CTGGCATAAAGTAGTTGAAAAGCTTTTCATTAGAGACGAATCTGGGAAATTACGATTAAA
AAGAGAATCAACTGGTCCCGAGTAGCAATTCTGTTCCAAGGTGCTTTTTCTCTCTTTTGT
GTATGATTGTTGTATGATTGAGAAAAGCATTAGTCATGTTCCAACAACTTATAATTCTTT
TGTATCCTTATAGCCCTGTAAAAATTCTTCTTTTTGTACGCGAGCCACCGTTGATGTACA
ATATGCAGCCCGATCATAAGTACGGTTGCAAATATTCTTTGTGCTATAGTTCCCTGTAGA
ATCATGTTCATTTGGTTTTCTGATGCTATCCTCTCAATTTGTTGTCCCTTAACATTGTAA
GTTTTTTCCTGCCACATTGTTGACTGTTTTTTCTGGGA