Microarray Probes on PGSC0003DMT400037826

Probe IDChipProbe Sequence
CUST_38881_PI426222305 JHI_St_60k_v1 TCAGTTTTCGTGGGAGATAATAATCAGGATCACGATGTACGAGTTTGTAAAAATTCCTCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400037826

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400037826 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G23240.1 +2 3e-24 99 70/120 (58%) ethylene response factor 1 | chr3:8295705-8296361 FORWARD LENGTH=218

Transcript Sequence (944 bp)

>PGSC0003DMT400037826 944 pgsc_dm_v3.4
CAACAACTTTGAGAGTCTCTTGACAACCCAAAAAAACACCAAAAATCAAAAGATGTCAAG
CAACTCAAGCCCACTAGAGATAGACACTTCATTTTCACATTCCAATTTGTTGTTTTTCCA
AGATCAATCACCATGGAGTAGTAATGATCTTTTCTTCAATGATCCATTTGTTGATATTGA
TGAATATCCACCAATAATTATACCATGTAATCATCAAGATATAGTTGTAGAATCCTCAAA
CACTACTACAACAACATCAAAAGCAAGTAGCCAAAATAGTCATCATGATCAAGAAGAGGT
AACATCACAAGAGAAAAAACAAGAAGATGATCAACAAAAACATTATATTGGAGTTAGAAA
AAGGCCATGGGGTAAATATGCATCAGAAATTAGGGATTCAACGCGTAATGGAGTTAGGGT
TTGGCTAGGAACATTTGATACTGCTGAAGAAGCTGCTTTAGCTTATGATCAAGCCGCATT
ATCAATGAGGGGTCCTTGGTCTCTTCTCAATTTTCCAATTGAAGATGTCAAAAAATCACT
TGAAAAAATTGAGTATTCTTGTAAAGATGGATTATCTCCAGCTGCTGTTTTAAAAGCTAC
TCATAAAACTAGAAGAGTCAAACACAAGAGAAGTAGTAAAAAGAAGAACAATCAAAATTT
AGAAAATGTTTTTGTTTTTGAAGACTTGGGAGTGGAATTATTAGAAGAGCTTTTAATGAC
TTCATCATAGAAATTACTATAGTCTTCGTGTCCAAAATACTGAGTTCAGTTTTCGTGGGA
GATAATAATCAGGATCACGATGTACGAGTTTGTAAAAATTCCTCTCTCTTTTTTTTTTTT
TAAAAAAAAAATTCTGGATTTCTTGAAGAATTTAGAGTTTAGTTTCAAGAAGAGCTTTTG
ATGAGTTGAAATAATGTTTCAGACTTGTTTGGTACATATAAATT