Microarray Probes on PGSC0003DMT400037169

Probe IDChipProbe Sequence
CUST_26455_PI426222305 JHI_St_60k_v1 GTGTTGCAATCAAATTTCATCAGAATTTTAACAGAGCCATATGTATTTGTGGACACTCCG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400037169

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400037169 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G48880.1 +3 5e-118 350 167/298 (56%) RNI-like superfamily protein | chr3:18127873-18129008 FORWARD LENGTH=309

Transcript Sequence (1286 bp)

>PGSC0003DMT400037169 1286 pgsc_dm_v3.4
GTTCCAGGTTATAGTTTCCTAGTTTCTTCACCTTCCTCAGACGTATTTGTACACTCTTCT
ATGTTTCTTCGTATTGCAGGGCTTAACTTTTTATTCTTCATGGTCTGAGTATATTCACTA
GAACACAAAATGACAATCAGAAACATCAATTTGACGTCAGAAATTCAAATATTCTTCATG
GATCTAGTGAAGTAATAACCTTTCTTGTTTCTACAGGAGTTTAGGAGATTGAAGCTGTTG
TTATGGAAAAAGGAGATTCTCCTGTAAGGAGATGGGAGGACCTTGATAATGATATCTTGG
TGAAGATACTCCAGTCCTTTGACCTTTTCCAGTTGATATATGCAGTTCCTCAAGTTTGTC
GTGCATGGCAATTGGCTTGTTCTGATCCACTTCTCTGGAAAACGCTGGACTTGTCGGTGT
TGCAATCAAATTTCATCAGAATTTTAACAGAGCCATATGTATTTGTGGACACTCCGTCTC
GTGAAAAATTGACCCGCCTCCTAAAGATTTGCATGAACCTCAGTCATGGAAACATAGAAA
CATTGATCTTCCATTACAATTTGTATGTTGACGACAATCAGTTGACTTATACTGCCAATA
GGTGTCCACGGCTTAAACGCCTTGTTATGCCTGCTTGGGAAAAACTAGAAAAGCCAGCAA
TACGCCGTGCTTTTCGTAAATGGAAAGATCTTGAATCACTGACCATGCCTAGTTTAGAAA
AACCTGCCTATGTCATCAAGAAAATTGCAAGGAGTTGCAAAAAAATTGCTGAGCTCAAAA
TTATGGGGCCTTGTGATATTCTGTTTGCGTCTACACTAGTATCATTTCTTCCAAACTTGA
AAGTGTTGAGTGTGAGGTGCACGGAGTTATCTAAATCTGCTTTGGTTATTCTCTTGGAGG
GGTTAAAACAGTTGAAAGTGCTCAACATATCGCATTGCATAATTACTGAAGATCTTCCTC
CACCCGCACCTACGAAAATTCTGACTGAGCTTGATGAATCCATTCTCGAAAAAGCATCTA
GGTTAGACAAGTTCCTAACCTGCATGAGTGACTCATGCATCATGTGTCAGCGCACTCGAA
ATGATGAAGGGTTCATGAGGTGGTACAAGTATGAAGACCTCTGGAAAGTGGATGAGGTGA
AATCTCTTGCAATTTGAAAACTTTAAGAATGTTTTGCTTCATGAGTTGAAGGTGCAGTGT
AATGTGTAAACTTGTGTGTATGAAACACATACAATAAAAACTTGTAACGCTACTTCTGTG
TTTTAAGTCTATTCTCTTTGACAGGG