Microarray Probes on PGSC0003DMT400037142

Probe IDChipProbe Sequence
CUST_26392_PI426222305 JHI_St_60k_v1 GAAACTGCAGCTAGAAGAAGATGAATTTGACACACACACACACAAAATAAGCTAAATGCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400037142

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400037142 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G62040.1 +1 4e-62 147 65/98 (66%) PEBP (phosphatidylethanolamine-binding protein) family protein | chr5:24922810-24923709 FORWARD LENGTH=177

Transcript Sequence (992 bp)

>PGSC0003DMT400037142 992 pgsc_dm_v3.4
AAAAGACCTATATATAAAGCCTCCTCGTTTGCAACATTACCAAATCATTCACCACTTATA
TTTAATTTCTTCATCACTCAACATACAACATTTTCAAAAAAAGAAAACAGAAAAATGTCT
TCTAGAGGTACTTGTGAACCACTTGCAGTAGGGAGAGTAATAGGTGAAGTAGTAGACAGT
TTTAGTCCAAGTGTGAAAATGAAAGTTATATACAATGGGAGCAAACAAGTTTCTAATGGC
CATGAGATCATGCCTGCTGTTGTTGCAACTCAACCTCGTGTCGAAATTGGTGGTGAAGAC
ATGAGATCTGCTTATACACTCATCATGACGGACCCTGATGCTCCAAGTCCTAGTGATCCA
TACTTGAGGGAACATCTCCATTGGATTGTGACAGACATTCCCGGTACAACTGACATTTCT
TTTGGTAAGTTTGATTCTCGAGTTGACTTTTCAGATGGTCACGCAACTGGTGAATCGTGT
ATAATTTAATTTTAAATTTGTGATTTACAGGAAGGGAGATAGTGTGCTACGAGACACCAA
AGCCGGTAATTGGGATACATCGTTATGTATTTTTGTTGTATAAACAAAGAGGAAGGCAAA
CAGTGAAAGCACCATCAACAAGGGATCAATTCAACACAAGGAGTTTTTCGGCGGAAAATG
GATTGGGATCCCCTGTTGCTGCTGTTTATTTCAATGCCCAGAGAGAAACTGCAGCTAGAA
GAAGATGAATTTGACACACACACACACAAAATAAGCTAAATGCACTTTGCATAGTGAAAC
CACAGTACAGACAAAAGTATTACTATTAGTACAACGTCCCCCAGGGCCTCACTGATTGAT
TTAAGAGATTCAAGTGTCATTGTCAAGCATATTATATAAGCTCATATTCAATAGTATTAT
ATTATATGTATGGTGTTTGTCGTACTCATTTGCTTATTTTCATAAATAAATAACATATGA
AACATGTTACGTGGAGTATGGAGAGGGTTGAG