Microarray Probes on PGSC0003DMT400037083

Probe IDChipProbe Sequence
CUST_26466_PI426222305 JHI_St_60k_v1 AACAAAATTAACCAAGACATCATGGAGGCACAATTGCACCGTCCACAGGATACAGGGTTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400037083

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400037083 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G52300.1 +1 7e-43 165 134/370 (36%) CAP160 protein | chr5:21237205-21239404 FORWARD LENGTH=619

Transcript Sequence (2480 bp)

>PGSC0003DMT400037083 2480 pgsc_dm_v3.4
AAAATTCAAAAAACAATTATCTTCATTTTCTTCCTTCTGAAAACTACTATTGTACAGTGT
ACACATTTCTTTCGAAACCCAAAAAAAATAAATAACAAAATTAACCAAGACATCATGGAG
GCACAATTGCACCGTCCACAGGATACAGGGTTGCACTCAGGGGAAGAACATGGTCAAGTT
CATGATGAAGGTGAACATCATCATAAGCAATCAGTGTTGAAGAAAGTGAAGGCAAAGGCA
AAAAAGATCAAGGATCATCTAAAACATGGTCTTGGACACGAGCATGGCCATGAACACGAG
CACGAGCAGCATTCACTCCAAGGCGACGAAGAAGAAAATGATGATGAAGAAATGGAGGAA
GGTGCAGAAGTTCATGGTGGACCATATGCTATTAGGAGTAAAGATATTCCAAAAGAGGAA
GTTGTGCCAATGGGCAATTTAGAGAATCCAACTAGCCCAAAGGAGGATCGTTATGATTCT
AAGATGAAGAATGAAGATGTGCATAGGCCAATTTTGCAGAGGCAAGACGAATTTGCGAGG
CCACCCTCTTTGGAGGGGACTCACTTCCCCGAAGAAAGGCATAAACCTGTTTTTACTGAG
ACGACCAAGGGCATTGATGATGATCATGTTACTGCCCTTGGAAAACATGAACATCAAGGA
CATGAAAATACTGGAGCACCAATGGGCCTAACGGATCATCATGCTGCCCACAGACCAGTT
ACTGCTGCCGAAACTCGCGAAACTAAGGGCTTTGATCATCATGTTACTGCCCCTGGAGCA
CAAGGTCATCAAGGACTGCAGGGGCATGAAAATATTATTGGAGCACCAACAGGCGTAGTG
GATCATCATGCTGCTGCCGCCCACAGACCAATTACTACTGCTGCGGAAACTCATGAGACT
AAGGGCTTTGATCATCATGTTACTGCTCCAGGAGCACAAGGCCATCAAGGACTTCAGGGG
ACTGAAAATATTATTGGAGCACCAATAGGTTTGGCGAATCCTCACGCTTCCCATTTACAT
GAACAGATGCATAGGCCACCTGTTGTTACCGATACAGGAGCCCGTGGCCGTGGGGAACTA
AATGATCAAGGACTGCAGGGGCACAAATTTAAAGTACTAACAGGTTTAGAGGAGGATCCT
AACGTTCCTAAAGACTATCCAAATCCGACAAACTATCAAAGCAAAGTCACCGATCCAACA
GGCGCCAACAATGAGGAGGCAGGTGTTAGTCCACTTGTTCAATCATTCGAAAAAATGGGA
GTGAACGATGTTCCGGAAACAACACGAATAAGAACAGAGCCAAAAGCAGGGGATTTTCAA
TTTGATCAAGGAACAGAACATAGCCAGTATACAGGATCACATGATCAATTTGCTCCGCAA
GAATCGCCTACAGTTTTCCCCTCAGTTCGTGAAAATACTGAATCAATTCCTAAGAGTATC
AATCCAAGCAATCCAGAGGATTTACCTCAGGACACACTAACTGGGAAACCAGGTAGCTAT
ACAGAAAAGCTTTCATCCGCAACATCAGCAATTGCTGATAAGGCGGTTGCTGCTAAGAAC
ATTGTCGCCTCCAAACTCGGGTATGGTGGAACAGAGGAGGAAACTCAGGCAACAGCAGGC
GATAAAGATGCAACAAAAACAACCTCAGCAACTGAATTTGCACAAAAAGCTGCAAGCGCA
GTTGCAGGAAAACTTGCTCCGGTTTATGAGAAAGTAGCAGTTGCTGGTAGCACAGTCGTG
ACGAAAGTTACAGGACATGAAAACAGGGGAGGTGTTGATGCAGAGCATGAAGTGAAGACT
GATAAAGGGGTGTCAATGACGGAGTATTTAGCAGAGAAGTTTAAGCCTGGAGAGGAAGAC
AGAGCACTTTCTGAAGTGATTTCAGGTTCACTTTCAAGACAGAAGGAGAAAACAGAGGAA
ACAGGGGAGGCAAAGCCAATGGGGAAGGTGACCGAATCAGTGGAAGTTGAAAGGCGATTA
GGTCCTATTGAATCCACAAAGAAAGAAGAAGAAGTTGGTGCTTCTGGAGAAACAAAAGTT
GGTGAAAATTTCGGACAGGGGGTGATGGATAGGGTTAAAGGTGCTGTAAGTACATGGCTT
GGGAAAGGTGTTGAAGCACAGGCAAATGATTCTGCTACGGGTGGAGGCGCTGTTGTTGGG
GGGAGGGGTTGAATGATCAAACCATGTTTTGCTAAATCTTCAGCAACCAAGCAATTGAAG
TTGTTACAACGATTTCTTTTACTTATATATATGCGTTTTCGCCTAATTTTCTTGTTGTTT
TGTTTATGGGAAAAGTGATCAGGATGCTGATGATTTCTAGGAAAGTTATACTTTGAATAT
TATGTATGTTGTTTTGTAAGTGTTCCACTGAAGTGTGTACTCATATTACATGTAACTTTT
TCTGTATCTATTGGTGGTGTATTCCTCAAAGGCCAACGTTGTTAGATTTGTATTGAGTCC
GTCCCTTCAAATTTTTTTCT