Microarray Probes on PGSC0003DMT400037014

Probe IDChipProbe Sequence
CUST_26366_PI426222305 JHI_St_60k_v1 AAAGATATTTTTCGCTCGGCCTCCGCTTTGCTGTTGCAGTTAGGGTTTCTTCAAGACAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400037014

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400037014 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G52040.2 +1 2e-71 243 164/332 (49%) RNA-binding (RRM/RBD/RNP motifs) family protein | chr5:21131081-21133318 FORWARD LENGTH=357

Transcript Sequence (2985 bp)

>PGSC0003DMT400037014 2985 pgsc_dm_v3.4
CTTATAATAAAACCTGACTTTTCAAAGATATTTTTCGCTCGGCCTCCGCTTTGCTGTTGC
AGTTAGGGTTTCTTCAAGACAAGGTTTAGCAGTCCCTGACATCTTCTGTTCAGGAAGGAT
GAGGCCAATTTTCTGTGGTAACTTTGAGTTTGAAACCAGACAGCCTGAGCTGGAAAAGGT
TTTCAAAAGATATGGGAAGGTTGATAGGGTGGATATGAAGTCTGGTAAGATTGTAACACA
TGTCAATTTTCTTTCAGTGCCACCTGTCTTATTTCTAACCTTGTTGTGTTAATTTTCCTT
TTTTGAATATGATGGACCCTGTTGGCGAGTTTATTGTGGCGATAACTTGTTACGGACACA
AACCCCTGGATTCATGGTGTACCATACTTGATATAAAATTATATGTACTTGATTAATTGG
GTGTCTTGTTAGGTGTTAACTACTTGTATGTGAGGCCTCCCCAATGAGGTCTTGTTATTT
TCTTTTGTGTATCTTAGAAATTGGAAATGTAATTCTCATTTCTTAGTACATGCACATCTT
ACTGCCAGTGAGTTTCTTCCTGCAGTAGGTACCTGGGTGTGATTTCATCTACTAGGGTAG
TTGTTTACATAACTGGATTCTTTCTTCTGTATAATCTTTATTCCTTATGTCTTGTTAACT
ATGGGCAATAAGCACTATGGCATCAAATGGTCTGGCCAAGTGCTATTTTGCCAATTGTTC
ATCAATTATATACATACTGCTAAACAAAGTTCTCTGCAATCCGAGTAAGACGGAGCCCAC
CACTATTGACTACCAGTAAAACTGGGCCAGATTATGTGAAGTCTGTGTCTTGCTAAAGTT
CAGCATAGCAAGCAACAATAAAGCTGATGGTTGCAAAGCGATTGAGTGATGAAATATGAA
CAAGGTTATTGCATCCCTTGGCCCGTTCTGTGTTTTCAGTGCTCAAATGACCGCAAAGTG
GTTTGATGTGGATGCTGCATTCCCATCTTTACATTGTGGCTTTGTTGGATGGGAGATCCA
GTCAAGCTTATTTGGCTCAACAGCAGAAGTCTTGTTGAGTTTTGGTGGGGTATTAGGATA
TGTTTACCGAAAAAGTGTATTTTTTTAAGCGTAGACCCCCATACTCAACTGATTCTTTGG
CGCAGGATAACATTGCAATGCCCATACCCATTGCTGATGGACGGTGTCTATTTCGTGTCC
TGACCGTGACAAGTTTCTCTTCTTGTTTCAACAAGAGCTCTCTGATCCATCATGGCATCA
CAATCACATATTATTCTCAGTCACTATTGCCCTCCATTCCTCGTGAATTTTGCCCCGTCT
TCATTTTCAGACTTGTCACAATGCCGGCCTCGAAGCTGAGGCAGCAGTTTAAAATGGAGA
AGGCACTCTTTTACATTATCCCATCATGTGACATCCACCTTTCCCTGGCATCTTTAGTCC
ACCACTGAAGGTTTTGCTTTTGTTTATATGGATGATGAAAGAGATGCAGAGGATGCTATT
CAGGGGCTTGACCGAATAGAATTTGGCAGAAAGGGACGGAGGCTTCGTGTTGAGTGGTCT
AAGGAAGAACGGAGCAGGAAGCCTGAGGGTTCTAAAAAATCTTCATCGAGCTTCAGAGTT
TCCAAGACCTTGTTTGTCATAAATTTTGATCCATATAATACTAGGACAAGGGATCTGGAA
AGGCACTTTGATCCATATGGAAAAATACTCAATATAAGGATCCGAAGGAATTTTGGATTT
ATTCAATTTGAATCACAGGAGGATGCCACTAGAGCCCTGGATGCTACAAATATGAGTAAG
CTGATGGACCGAGTTATCACAGTGGAGTATGCAATCAAAGATGATGATGATAGGAAAAAT
GGATATGGTCCTGGTAAAACCTATAATCAATCACCCAGGAGAGGTTATGACCGAGGCCGA
TCTCGTAGTCCACGTGGAAGAGATAGGCTGAGTCCAGACTATGGTCGTGGCCGAGATCGG
CCTAGTCCAGACTATGGTCGTGGTCGAGATCGGCCAAGTCCGGACTCTGGTCGTGGTCGA
GATCGGCCAAGTCCTGACTATGGTCGTGGTCGAGATAGGCCTATTCCTGACTTTGGTCGT
GGTAGAGATCGGCCAAGTGCTGACTTTGGTCGTGGTAGAGATCGGCTAAGTCCTGATTAT
GGTCGTGGCCCTAGTCGAAGTCCTAAGCACAGGGAAAGGAATTCTGAGTATGGCCGTGGC
CATAGTCCAGTTGTAGGAAAGGAGAGAAATCCTGGTCATGGGAATGTTCGTAGCCCTAGC
CCTCGTAGGGAAAGAACAGGTCCAGGAAATGGTCTTATGAGCAGTCCGCTGAAAAACAGA
AGTCCTGGTTATGGTGATAGACCCGGTCCTAGTCCTCAAAGGGAGAGAAGAGATAAATAT
AGCCTGGATGGTTATAATCGTGGCAGCAGCCCAGGTCCTAAACTTGAACCAGTAGGAAGT
CCTGTACGTGATGGGAGGGGAAATTCGGAGCGATGCAGGAGGTTTGCACCTCACTAGTTT
ACTTTCCCTTTGTCTGGCCTTTTCTTTTTGGTGTCTCTGTGCTCTGTTGCCAGTTGTCAT
TTTTGATGTCATCCTAGACGTGTTGTACTTTAAAATCATTTTGTTGGTGTTGCAGTCGTT
CACCTCCAGCTCGGGAAAGATCGCGCTCCTGATTTGCTTGAAGCTGTTTTGATACTTGGA
GTAATATCTGTAGAATGGTTATGTTGAAAGTGGTGCTTGTAGAATTACACCTTGAAGTTG
CTGGAACATCAAAGTAGCATGTGGGTTTTAGAACCAATGTAATATACCTTGGGAGATAGT
TTTTGCTGTTGGAAGTGATTTAGAACTGCTACCGTGTATCTGCCTTGTTTACTGGATACT
CTCTTTTCCATTTGATACTGATCTGGTAAGACTTGGGCCATATCATTCTTAGCTTGGCTT
TACCAACAAATTTTATTTATCCCCGCAGCCTCAGTGTGATGATTA