Microarray Probes on PGSC0003DMT400036858

Probe IDChipProbe Sequence
CUST_6598_PI426222305 JHI_St_60k_v1 CGTGCAATAGACAGTATTCTTCAAGCGCTCCGAATAGTTTTTTAATGACATTTACTTCAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400036858

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400036858 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G24100.1 +1 5e-22 96 66/181 (36%) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G30780.1); Has 101 Blast hits to 101 proteins in 16 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 95; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink). | chr2:10244921-10246715 FORWARD LENGTH=466

Transcript Sequence (898 bp)

>PGSC0003DMT400036858 898 pgsc_dm_v3.4
TAAGGCTTAGTATTTGTGAATTGTCTTATAATCTGCTGTACTGTCATTTAACCTGCAGTG
ATGGATACAAGGGAAATTCAAGATGTCAGTAGAGATATGGAGCAATTGAAAGGCCTCGGC
AACCTAGATCAGATCCGAGTGCCTGGTCTTCATCCTTCCATGTCAATGAAAGATTTAGTG
AGCCACTTTGAACAACGTTTTTCTGAGCAGGGAACGTCCGAAGTTATATGCCTGTCCAGT
GATGAACGCCAAAGCTTGGAGATTCTGGAAGAGATCTCGAGGTGCTTGTTTAGTGATACT
CAAAATATGCCAGCATCAGATGAGAAATCCCTCATGACAAGGGTCAATTCTCTGTGCTGT
CTTCTTCAGAAGGATCCCGCAACAGCTCATAAGAGTGAGAATTATGATGATGTTGCAGTT
GGAGGTAAGAGAACTGATGAACTGATCAGTTTCTTTCCCGGAGATCCTTCTACATCAGAG
GATAAATCAAATGATCCAGCTCCATCAATGTCAAGAAAAGACTCGATAGGGGATCTGCTG
CTGAATCTGCCTAGAATCGCATCGTTGCCTCACTTTCTCTTCAATATCTATGAAGATTCC
GACCACCCAGCTAGATAGAATCTGCTTAGTTTATCATCATCCAGAAAAGGATAGCCTAGT
TGCTTTTGTATATAGCAGGCATAGCGCCCTCTAAGACACTGCTTAGCTACAGTGTCCAGA
TGTTGTGCAGGTAGTATATGTATATAGTCATCTTTTATGTTAGTTCGTGCAATAGACAGT
ATTCTTCAAGCGCTCCGAATAGTTTTTTAATGACATTTACTTCATTTTTTGTAAAAATTT
TACCAAAAGATACCTCTTTAACTGGTATCTAACAACTTATCCTTTCAAATGTTGATCG