Microarray Probes on PGSC0003DMT400036706

Probe IDChipProbe Sequence
CUST_6668_PI426222305 JHI_St_60k_v1 GCCAATAACGACTCGTTGGCGATAATATCTTTGCTTAACATACATAACTATTTGAGGTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400036706

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400036706 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G79720.1 +2 0.0 534 268/439 (61%) Eukaryotic aspartyl protease family protein | chr1:29997259-29998951 REVERSE LENGTH=484

Transcript Sequence (1667 bp)

>PGSC0003DMT400036706 1667 pgsc_dm_v3.4
CCTTTGTTGTGTATGTTCATCTATAGAGAGCTTTAAAACAATGTCACTTTGTCAATATTC
CATTGTATTTGCTCTTCTTTTTGTAGGAGCATTTGGATATGGAGATAATGAACTATTTCT
CCCACTCAAAACACTTCAAAAGATGCATCACAAACATAATGAGCCAAGTTGTTCATCTCA
AAAATCAAGGAGTGAAAATGGAGCAATTATACTGGAAATGAAGCATAAAGATTACTGCTT
TAGGTCAAGGGGTGACTTGAACAAAAGGCTGCAGAAGAGATTGCTAGCTGATGATATTCG
AGTTCGTTCGATACAATCTAATATCAAGAAAATCAGTTCTAAGCAAGTTGAGGCTTTATC
ACAGACTACTACTACTCAAATTCCTATCAATTCAGGTGTTACAATGCAGACTCTAAATTA
CATTGTTACTGTGACATTAGGCGGTCGAAATATGACAGTGATTGTGGATACAGGAAGTGA
TCTTACTTGGGTTCAATGCCAACCTTGTAGATTGTGTTATAATCAACCAGAACCACTTTT
CAACCCCTCTATTTCCCCTTCTTTTCAAACAGTTGCATGCAATTCATCAGCCTGTCTGTC
TCTTGAATCTGCAACTGGGAATTCAGGATTGTGTGGGACTAATTCACAAACTTGTGGTTA
CCTTGTAAGTTATGGAGATGGATCGTATACGAAAGGTGATCTTGGACAGGATCATTTGGT
TCTTGGAAGAACATCAGTTGACAATTTTGTTTTTGGGTGTGGGAGGAATAATAGAGGCTT
GTTTGGTTTAGCTTCAGGTCTTATGGGACTTGGAAGGAGTGATCTTTCTTTAATATCTCA
AACTTCTGGTGTATTTGGAGGTGTTTTCTCCTATTGTTTGCCTTCAACTGAGGCAGAGTC
CTCTGGTTCTCTTATATTTGGGGGTGATCCTTCAGTTTTCAAGAACTCTACACCAATCTC
TTACACTAAAATGGTTCCAAATCCACAGCTTTTTAGCTTCTATTTCCTCAATCTAACTGG
AATGACTATTGGTGGGGTTGCTGTTCAAGATTCAAGTTTTGGGAAAAGTGGATTTCTCAT
TGATTCGGGCACGGTTATCACAAGGCTCCCTCCTTCCATTTACAAAGCTGTCAAGGCTGA
GTTCTTGAAACAATTTTCAGGTTACCCTTCAGTACCAGGTTATTCAATTCTTGACACTTG
CTTTGATCTCTCTACATATGAAGAAGTGAACATTCCCACCATAAAAGTACATTTCGAGGG
CGATGCTCAGATGGAAGTTGATGTTGCTGGGGTTTTCTATTTTGTGAAGAATGATGCATC
TCAGGTCTGTTTAGCACTGGCAAGCCTGCAATATGAAGGTGAGATTGGAATTATTGGAAA
TTTTCAGCAGAGAAACACAAGAGTCATATATGATACAAAACAATCACAAGTTGGATTTGC
AAAAGAAACCTGCAGTTTCATGTAGATGACAGAAAAAAAGGTAAGGCCAATAACGACTCG
TTGGCGATAATATCTTTGCTTAACATACATAACTATTTGAGGTTTATTTATCTACTATGT
AGGAAGATACAGATGATATTATGGGTGTTTAATTAAGTGTAAAATATCCCATAAACTTCT
CTTCATGATGTAACACTTCCAATCATTTTATAATATGTGAAAACTGT