Microarray Probes on PGSC0003DMT400036110

Probe IDChipProbe Sequence
CUST_34561_PI426222305 JHI_St_60k_v1 GGACAAGGGGTACCTTTATTGGCATGGCCAATTAGAGGTGATAATTTTTATAATGCAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400036110

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400036110 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G34131.1 +1 4e-38 140 78/270 (29%) UDP-glucosyl transferase 73B3 | chr4:16343268-16344713 REVERSE LENGTH=481

Transcript Sequence (813 bp)

>PGSC0003DMT400036110 813 pgsc_dm_v3.4
GTAAAGGTTACAAGTGCCATTCTTGTGAACACATATGATGTACTAGAACACACATTCTTG
GAATATTTAGCCAAACAAACAAGACTTCCAATTTATGGAATTGGCCTTCTACCAGAAAAA
TTTTGGTCACTTACATCCACTAAATCCCTAATCCATGACAAAGACATTAGAACAATTAAT
AATTCAAGTCAAAAATCAAATTATTCAGAAGATGAAGTACTCAATTGGCTAAACACAAAA
TCATCAAATTCAGTAATTTACATCTCTTTTGGTAGTGAACTTTTACCAACTTTACAAGAA
CATGAAGAAATTTCAAAGGCACTAGTAGAGCTATCAAGTCAAAATTTCATATGGGTAATT
TCCAAGAATCAAGATTATTATCCTAATGACTTGGAAAATAAAGTTGGAAATAGAGGTTTG
GTTATACATGGATGGGCCCCACAATTGTTGATTTTAAGTCATCCGTCCACTGGCGGATGT
TTGTTTCACTGTGGATGGAATTCGACTATGGAAGCGATTGGACAAGGGGTACCTTTATTG
GCATGGCCAATTAGAGGTGATAATTTTTATAATGCAAAATCTATTGTGTGTCATCTCAAG
ATTGGTTATATGGTATCATCAATTAGAGAAAATATTGGGTTGAAAAAGGTTAAGAAGGAT
GAGATTATACAAGGGATTAAGAGATTAATGGAGGATAAACAAGTTCATGATAGAGTTGAA
GAATTAAGTGACAAATTTAGAAATGCTAATTTTCCAGTTGGTTCAATTGCTAATTTGCAT
GATTTTAAGGATTTTATTATGCAAGCAAAGTGA