Microarray Probes on PGSC0003DMT400036036

Probe IDChipProbe Sequence
CUST_15893_PI426222305 JHI_St_60k_v1 GAGAGTTGTCAAATGTAGTTAGTTATGTTGGAGCAATGTAACTAACACTCGGTTTGGATC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400036036

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400036036 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G21350.1 +1 3e-103 325 214/370 (58%) plant U-box 8 | chr4:11356143-11357267 REVERSE LENGTH=374

Transcript Sequence (2214 bp)

>PGSC0003DMT400036036 2214 pgsc_dm_v3.4
TATATATATTATCTATAGATAGATACGTATAGAAAGAGAATCTAGAGAGAGAAAACAGAA
ACCCATTTCCCAGAAGGAACAAAAATAGAAATGGCAACTTCAACCCAGTTCCCGGACGAT
TTTCGGTGCCCGATTTCCCTTGAGATTATGTCCGACCCGGTTATTCTCTCGTCGGGTCAT
ACCTTCGATCGCTCTTCAATCCAACGGTGGGTCGACTCCGGCCACCGGACTTGCCCGATC
ACCAATCTACCCATTTCCGACCCGGTTTCTCTCATCCCTAATCATGCCCTTCGGAGTCTC
ATTTCCAATTATACCCTCGTCTCTTTCCCCAAACCACTGGCGTACCCTGACCCACAGTCC
CTTATTCAAACCCTTATTGCTTCTTCTTCTTCTTCCAATTTGGATTCTAAGCTCAACTCG
CTCGACCAACTAAGTAAGCTTTCTAAGCGTGACTTAGCGATCCGAAGGAAACTCACTGAG
TCAGGCGCTGTTTCTGCTCTTCTCAATTGCGTTAACTCGGATGATGACTCGGGTGGTTTG
CAGGAGAAAGCGCTTCATTTGTTGTTGAATTTGAGCTTGGATGATGATAACAAAGTGGGG
TTGGTGGCAGAAGGGGTTGTGGGGAAAGTGGTCTCCGCTTTACGAAGAGGTGCTGGAGAC
TCGAGGGCGGTGGCCGCCACGGTTTTGACGAGTTTAGCGGTGGTGGAAGTGAATAAGGCA
ACAATTGGGGCATACCCAGATGCAATTCAAGGGTTAATTTCGCTGCTTTGGGGTGGCAGC
GGTAGAGAGAGAAAGGAAGCTGCTACTGCTCTCTACACGCTGTGCTCTTTCCCCGATAAT
CGGGTTCGGGCCGTGGAAAACCAGGCTGTTCCAGTACTGATTAAGAATGCTAATTCAGGC
CTAGAAAGATCAGTTGAGGTATTGGGATTATTAGCAAAATGTAGAGAGGGTCGTCAAGAA
ATGATTAAATACTGTGGGTTATTGGATGTTTTGATAAAATTCTTGAAAAATGGGTCTTCA
AGAGCTGTGCAATATGCTCTTTTGACCATCAGTTTGCTGTGTAGTTACAATGAAAGGATG
CGTGTGTTGGCTGTAAGAGAAGGGGTGTTTGAGATTTCTGTTGGCTTATTAGAAGATGAT
AATGAGAAAGTGAGAAGGAATGCTAATAGCTTGATTCAGGTTTTACAAGGGAAAAGATTA
AGTCTTTGATTGGTTTATAAGGAAAAGATGTGAATTTGGCAAGTGTTGATTTTGAATGGA
TTATGGAAGCTTTGGAGGGTGAAGAAGAAGGTGAGTTGGGCTTCCTCAAAATTATTTTTG
TTGAATAGTTTTTCTTTGTACAAAAAGATTAGAATTTTAGGGAAAAAAATGTGTATCTCT
CTTTTCATCTATCAATCTCTCTTTCTTTTTTTTTGGTTTTATATTTTCAAAATAAGAATG
AAAAAAAAAAAAAAGATCAATGGTTCTTTCACTGTCTTTCTCTTGTCTCTTCCATTCTCC
TCATGAGTTCTGTTGATGTAAAATTAAAAATCTAATATTTCCAGTTTTTCCTTTTACATT
AGTAAGAATGATCAATGAGAGCCTACATATAGCTGCTTATAAACAGTATACAAATACAAT
AGTGTCATAGATATTTTCTAGTGCTGGTAAAGAAGAAAGATTTGTTCTGGCTATTTTTAT
CCACATTGGTACACTTGCTTAAAGATTTCATTTGTGGTACTTTTTGTGCATGGAAAGGGG
TGAGCACATGATTGATTTGATCTTGATTTTTGGATTTACACCTTACATATTAAGACTGAG
ACTGTCCCACCTCTATTGCTACTTCATCAATTTTCATCTAACTGGATTGTAATCTGCTAA
TGGCTAAATGGTTGCTGTTAGTTGAGGTTACTACAAGCCAAAACACTTCATTCTCCAAAT
TGTTTAGAGGCGGATTCAGAATTTTGAGTTCCAGAGTTTGAAATTCTGGATAAACCGGCT
TATTGGGTTTGCAAAAACATAAACTCGTGAGCAAAAGTTGAGAGTTGTCAAATGTAGTTA
GTTATGTTGGAGCAATGTAACTAACACTCGGTTTGGATCATTGTTTCATAATGTATTGTA
TTCTATTGTACTTTACTGTATGGTAGATACAATGTTTGGCTAGACTGTATTGTTTGTTGT
TGTTTAATAACATTTTTATTGTTGACTGTATCATACTGTATTGTAATTTATAAA