Microarray Probes on PGSC0003DMT400036020

Probe IDChipProbe Sequence
CUST_15853_PI426222305 JHI_St_60k_v1 CTTGGGTATTGGCCTTAATTCTTCATCAACATCAGATAATAATTGGAGTCATACCTTGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400036020

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400036020 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G61660.1 +1 2e-58 204 171/485 (35%) basic helix-loop-helix (bHLH) DNA-binding superfamily protein | chr1:22754003-22756171 REVERSE LENGTH=393

Transcript Sequence (1966 bp)

>PGSC0003DMT400036020 1966 pgsc_dm_v3.4
CTTCTTTCTTTTTACAATGTCAACCAGATTCCGGTAGTTTCTCCTCCCCACCCCTACCCC
TATATATATATATATAAATACAACTCTCAGTTCATAAATTCAGTTTCATGTAATACAAAA
CACACAAGTACTATTACGACTACTCGAGCTTTATTGAAGGAGAAGAAGAAGTATAGTTTT
AATTATTTACGAGTGAATAAAAACAAATAAGTTATGGGTGATGAATATCAAGCAAGTGTT
TGTGGAGGAAACTGGTGGAATTCAAGTAGAAGTATATTTGGTTCATCACTATGTGCATCT
TCAGTTCCTTTAGGGAACTCTAATTTTGCATGGACAAATGATCATTTGTTGGATATGAAA
TCTTCCTGTAGGTCTAACGATGAATCTGGTAATTCTGATGAATCTGTTGTTCTTCAAGAA
TTACCTAAACATGATTCCACTCTACAAATCTTGGGTATTGGCCTTAATTCTTCATCAACA
TCAGATAATAATTGGAGTCATACCTTGATGCATGGAAATGATAGGAGTGAAAGTAGTTAT
CCTTCAATACTACAGGAAGACCTAAATTCAAGCATGAATTACCAACAAGAAAGTGGGGTT
GATTGTTCAAGCAACTCATTTAAACAAGATTTCACTTTAGGAATGAATCATCCAATCACT
AGCTCAACTAATACTCATCATCATGATCAAACCTTTCCAATGAATTCATCTTTCCCTAAT
TATCCTTCAGCTTTACTTCAAACTTTATTTGATAATGATCCTCCTCCTCCTCCTCCTCAA
CAACAACAACAACAATTACAACAATCTTTGTTTGCTACTAATAACAACCAACCAATGAAT
TTCCCAACATCATCCTTAAACTACAGGCCAGATTTGAATGACTTTTCACCTTCTATGTCT
AAATTCCGTAATTCCTTGTTGATACCAAAACAAAGTACACCTTCTGATCATTTTCCAAAT
TACTCTCTTAATGTTACCACTTCTCTCTACAATACTTCATCAGCCACATCCTTAAACAAT
ATGCGCGGTACTCTTATGCCTTGTATGCATCCACAAATTCTCCAGTCACCATCATTTAAC
GAGAATTCCAGAGCTCCTAACGTTACTCCAAAGTGTAAAGTTGAAGATTTAAGAGAATCG
AGGGTGACTAAGAAAAGTGTGAATAATGAAGCAACATTGAAGAGGGCAAGAATAGAGACA
CCATCACCATTGCCAACTTTTAAGGTCAGAAAAGAGAAATTGGGGGACCGTATTACTGCT
CTCCAGCAATTGGTTTCACCTTTCGGAAAGACTGATACAGCTTCAGTTCTCCATGAAGCT
ATTGAGTACATCAAGTTTCTCCATGATCAAGTCAATGTACGTTAATTACTCAAATTAATA
AATAATGATTCAAATTAAACTTACATGTTCTTTGTTTTTATTTAATTTCAGGCTCTTAGT
ACTCCTTATTTGAAAAATGGATCAAGCACTCAACACCAACAGATTGTTGATAAGGTTAAG
GAAGAAGATTTGAGGAGCCGAGGATTGTGCCTGGTACCGATATCGAGTACTTTTCCAGTA
GCAACTGAAACTAGTACAGATTTTTGGACTCCAAATTTTGGTGGTACGTTCAGATAGAGA
GGCTTGAGACGAAGTGATTTATTTTTTACGTACTAAAAGGGAAAGTGAGTATTGACAGCC
AATGCTAGCTGGGCCATATCTACAGGCAGAATGATGTGTTGGTAGGCTAAGTACATGATT
ATAGAGAAGATTAAGTGTAGAGCTGTAATGACATTAATTAATTAATAATCGGCTTGGATT
AGGAACAGGAACAAGTGCTAAATTTAGCTAAGACTACTTTATTTTAACATTTGTGTTTAT
GTTTTATGTAACTTGTTGTTTTGTTGCTCTTGGATTGGCTGAATTTAGCACATCATAAGG
AACTTTTTGTTCCTGTTTCTAAATATTTATATATTTAAAATGTTCG