Microarray Probes on PGSC0003DMT400035603

Probe IDChipProbe Sequence
CUST_39118_PI426222305 JHI_St_60k_v1 GGAAAAAAGACAACGAGCTCTTGTTATTAATGTGTCGTTTGTTGACAAGTAGTTCTTCAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400035603

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400035603 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G35320.1 +3 1e-28 114 94/255 (37%) unknown protein; Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | chr5:13521893-13523144 FORWARD LENGTH=225

Transcript Sequence (1495 bp)

>PGSC0003DMT400035603 1495 pgsc_dm_v3.4
GAAAAATCTAGACTTGGGAGAAGAGTCTACAAGCTTCCATTATTCTTCCTATAACTGAAA
TTCTCAACCTCGTTCTTCTTTCACTTTCATAAACCGAGCTCTCCAACTACCTAACAACAC
TCTGGTTGCTGCTTTGATCGATCGTTTGAGAAGGAGGTAGGTAGCATAAATTTGTGCAAA
TTGATCTCTGATAGCTTTTTAGGGTTTTTTTTGGACGCTGTTGTTAAAAGAAGAATATGG
AGCCATACTATACATTGAAGATGAAGAGGAAGGATTTGGAAGATGTTTATGATGAATTTT
CTGAATTTTCACTTTCTTCTCCCGCCAGAAAAATTCGTCGACTGGATGCAGATTTGCCTC
CCATAATAGAAGAGGTTGAAGAACCAGAGATTCCTATAGCTTTTGAGCAAGCAGCTACTT
ATCCAAGCTTCGGAAGCAATGCAGTAAATAGGGGTCTAGTAATTGAGGAACTGCCAAGTG
TGCCCGAGAATGAAGAGAGGGCAATTGTTCTATTCAAGCCCATGAACACACAGCCTGTGC
ATTCCCCTTCTAATTTCTCCGTTAAAGTGGATCCCCAGTTTCTTAATGGTCTCAAAAGTC
AAATCTTCTGGGATAACACTGCAAATGCATTTAGACTAGTTGACAATGAAGCAACGCAAC
AGGACGACTCTAGTTCTGCAAAAGAATGTCTAGCGGTTGTTCCGTGGGTTCCATCTCAAT
TTCCTTCTGCAGCAGAAGCTGAAGTCCTTAGTCAACCTGATGTTTCAGATATGATGGATG
CTGAAGATATGGAGGGAGTAGCTATGGATATTGAAGATAACAGTGTGGATGTTGAACCAA
GAACTGCAGTCGAGGCTGGTGCAGTTGGTGTAAATGATGGTTTTCATCATTGGCAACAAC
AGCATTGTATGACGACGACTCAACTGCCTCAGAACACATCAACACCTATTCCCTGGTACC
GGTAATTGGCATATAAGGATTAGGATGTTATAATTACGATTAGATATTATTAGAACTCTC
CATGGGTCTCCTCTTGCAAGGAAGCATTGGTTAGGTAAAAGAGGGTGAAGTAAATAGTAG
ATAAAAGTACTAGAATGTGAATTGAAAAGGTCAGGAGACCGTTATGTTAAATTCAGCAAG
CATGGCCTCTAATATGTCGAGCGAAGAGCTGCTTATGGTTTTCTAATGTCTCCATCATTC
TCCATATCTTGGATATGATTTTTCTTTAGTTGTTATGCCTATTTTGCTTACACACTGATA
GAGATTGTGGAATGGAAAATAGTCACTTTGGGAACGAAATTTGTTCAACTCATAATAGTT
AAAGAGGAAAAAAGACAACGAGCTCTTGTTATTAATGTGTCGTTTGTTGACAAGTAGTTC
TTCATAAAATTATTTTGGAAGTTTGTAATCACAAAAAAGAAATATGGAAATATGTGATTT
GGTATTGTACGATATTTTGATATTTTATTCATGAATTGGAGAAACTTCATACTTT