Microarray Probes on PGSC0003DMT400035541

Probe IDChipProbe Sequence
CUST_44206_PI426222305 JHI_St_60k_v1 ATTCATGGGATATTGAGGATGAGAATGCTGAGCAGCTTATTATTGAGGAAGATAGCCGCC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400035541

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400035541 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G76490.1 +1 1e-41 150 85/183 (46%) hydroxy methylglutaryl CoA reductase 1 | chr1:28695801-28698206 FORWARD LENGTH=642

Transcript Sequence (648 bp)

>PGSC0003DMT400035541 648 pgsc_dm_v3.4
ATGGACGTTCGCCGGCGACCTGTTAAGCCTCTATACACATCTAAAGATGCTTCCGCCGGC
GAACCTCTGAAACAAGAAGTTTCTTCTCCTAAAGCATCTGATGCGCTTCCACTCCCATTG
TACCTAACCACTGGGTTGTTTTTCACCATGTTTTTCTCTGTTATGTATTTTCTTCTCGTA
AGGTGGCGTGAGAAGATCCGTAATTCTATTCCTCTTCATGTGGTTACCCTTTCTGAATTG
TTAGCTATGGTGTCATTGATTGCTTCCGTTATATATCTTTTGGGTTTCTTTGGGATTGGG
TTTGTTCAGTCGTTTGTGTCCAGGTCGAATAGTGATTCATGGGATATTGAGGATGAGAAT
GCTGAGCAGCTTATTATTGAGGAAGATAGCCGCCGTGGACCATGTGCTGCTGCCACTACT
CTTGGCTGCGTTGTGCCTCCACCACCTGTTCGAAAAATTGCCCCAATGGTTCCACAGCAA
CCTGCTAAGGTAGCTTTGTCCCAAACGGAGAAGCCTTCGCCAATAATTATGCCACCATGT
GCTGCTGCCACTACTCTTGGCTGCGTTGTGCCTCCACCACCTGTTCGAAAAATTGCCCCA
AACGGAGAAGCCTGCGCCAATAATTATGCCCGCATTATCGGAAGATGA