Microarray Probes on PGSC0003DMT400035462

Probe IDChipProbe Sequence
CUST_44209_PI426222305 JHI_St_60k_v1 GCAATGAGGTCAACATTGCCTGTGCTTTCTTTTCAACATGTGTTATTACTTTTAAGTTTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400035462

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400035462 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G20170.1 +2 0.0 550 294/524 (56%) Domain of unknown function (DUF23) | chr4:10896810-10898794 FORWARD LENGTH=504

Transcript Sequence (2042 bp)

>PGSC0003DMT400035462 2042 pgsc_dm_v3.4
ATTAAATTGCAGAAATCACCATTGTTGATTTATAAGAACACAAATCACCTTCTCACAATA
CAGAATTCAGTATAGAGAGAGAGAGAGAGATAGAGAGAGAATACTGGAAAGAAGCAGTAG
CATTGTAAAGAAGAGACATCTAGATATACTCTAGAATAACCAAAAGCCTGTCTGCCTTCT
CTTTTTTTTTTCTTTTCTTCTTCTTATCTATCTCTACTGCTCTGTCGTCTGCTTATCTTT
ATATTTCAGTATGAGTAAGGAGAAAGAACGGAGGATGTTCGTTGGTGTTGTTTGGAATTG
TGCTGCTGAGCTTAAGCTTCTTCTTACTGTTTTTCTTTTTCTCTGTTCTCTTATTACACT
TCTTCACTATATCCCTTCTCGTTTAATTTCTTTCTCCCCTATAGATCTTGGCAGCTGTAT
TTCTACTCCCGCCGCCCCACTTCACTTTGTTTCCCACTTAAACGCTACTAATTCATCAAC
CCCATCTGCTACTACTCCACCACCGATGAGTGCTGCTACTCCACCACCAGAGCCGCCGTC
GTTGGAGAAAGACAGACTGCTAGAAAACGGCGTCGTTAAGAGAGCTTTCAACCCTTTTGG
CTCCGCCGCGTACAATTTTATTCTGATGTCTGCTTATAGAGGAGGTTATAACACTTTTGC
TGTAATGGGTTTAGGTTCAAAGCCTCTTCACGTCTATGGCAAACCCAGTTACCGTTGTGA
ATGGGTTTCTTCTCATAAACAGAAAAACCCCATCTCCGTCGTTGGTCACAAGATCCTCAC
GGACTGGGGTTATGGCAGGGTTTATACTGTGCTAGTCATAAATTGCACTTTCCCTGTACC
AGTTGGCAACGGCGAAACTGGCGGAAAACTTCTCGTTCACGCCACCACCAACGGCGGCGG
CGACACTAACTTTAACACCACCGACACTTTCGAGGCATTGTCGGAAACGGGACAGGATTT
TGTCAACTTTACTTCCGTATATGAAGCTCCCCCAAAGTATGATTTCTTCTACTGCGGTTC
GTCTCTGTACGGGAACTTGAGCCCACAGAGAGTAAGAGAGTGGCTGGCATTTCACGTTAG
GCTGTTCGGAGAGAAGTCCCATTTCGTAATTCACGATGCTGGAGGTGTACATGAGGGGGT
AATGGAGGTGCTTAAGCCATGGATGGATAAAGGATACGTTACATTACAGGATATTAGGGA
CCAAGAGAGATTTGATGGGTACTATCACAATCAGTTCCTTATTGTCAATGATTGCTTACA
TAGGTATAAGTTTCAAGCTAAATGGATGTTCTTCTTTGATGTGGATGAGTACATTTTTGT
ACCCAAGAAGAGCACCATTAAATCTGTAGTGAAATCTTTATCGGATTTTACACAGTTCAC
CATTGAACAGATGCCAATGTCTAACAAGCTTTGTCTCGAAGAGGACCGCGGTAAATCCTA
CAGAAAATGGGGGTTTGAGAAGCTAGTGTACAAGGACGTGAAGACGGGTATTAGGAGGGA
TCGAAAATATGCAGTACAACCTCGTAATGTGATCGCCAACGGTGTGCATATGTCTCAGAA
TACTGTAGGCAAGACAACACACAAGACAGAAGGGCGTATCAAGTACTTCCACTATCACGG
GACCATTGCAGAGCACCGTGAACCATGCCGGCAGCTGGTCAACACCACGGCAATCACCGT
TGACGGTATCCCTTATAATGTTGACACTACAATGAGAGATGTTGCTGCAACTGTTAAGAG
ATTCGAACTTAAGATGATTGGCACTACATTACAAAGAACGCGGCAATGAGGTCAACATTG
CCTGTGCTTTCTTTTCAACATGTGTTATTACTTTTAAGTTTCTTTTGGTTAGAGCTATAT
ATATATATTCTTCTCTTGTTCATTTCTGTATGATAAAATTTTCTTATACTTTTTGGAATA
GAAGCATGGGTATAGAAACAACAGTGACAAGCATATTAGTATATGATTCGTTTATTTATA
TTTGTAGGATTACAGGGTGTTTTTGTACTGTTTTGTCTTGTTTATAACACTATTTAATTT
GC