Microarray Probes on PGSC0003DMT400035301

Probe IDChipProbe Sequence
CUST_26849_PI426222305 JHI_St_60k_v1 GAGGAATCCGCACTGTCTGAAGCTGCAGATGGGTTGCAGGATTCTATAGACAAAATTTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400035301

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400035301 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G40010.1 +1 2e-157 461 255/479 (53%) AAA-ATPase 1 | chr5:16020218-16021762 REVERSE LENGTH=514

Transcript Sequence (1416 bp)

>PGSC0003DMT400035301 1416 pgsc_dm_v3.4
ATGAGATTGCTACAAAGTTGGGGTGGTGTCTGGACCAGCATCGCTAGTTTCATATTCATG
TGGGATAGGATCCGTCGATACTGTCCCCCTGAGCTTATCCGAGCTTCTGATAAGTGGACA
CAAAGAATCAGGAGCTTTTTGTACCCTTATATTCAGATTTCCATCAGTGAATTCATGAGC
AACAATCTCAGGCCTCATGATGCCTATTCAGCAGTCGAGGCGTATCTCAGTGTCCACTTA
GCAAAAGAAGCAAAGAGGCTTAGAGCTGAAACGGTAAATGGTGGGAGCAAGTTGGTGCTA
AGCATGGATGAACATGAGAGAGTTACTGATGAGTTTTGCGGAGCAAAAATACAGTGGATT
TCAGGCAAACTTGTGCAACGGGAAAGTAAGTACTTGCTAGAACTGGAAAGAAAATATTAC
AAGCTTATGTTCCACAAGAAATATCGTGACATGGTAACCGATATTTACTTGGAGCAAGTG
ATCAAGGTAGGGAGAGAGATTCAGATGAGAAACAGGAAGAGAAAGCTCTACACTAATAAT
GGACACAGCAAGACCACATGGAGCCATATCGTATTTGAGCATCCTGCAACATTTGGTAGT
CTGGCAATGGAAGCAGAGAAGAAGCAAGAGATTATGGATGATCTCCTCTTGTTTAGAGAT
AGCAAGGATTTCTATGCAAGGATTGGCAAGGCGTGGAAGCGTGGTTATCTACTATATGGT
CCCCCGGGTACTGGGAAGTCTACTATGATTGCTGCAATGGCAAATTTATTGGATTATGAC
GTGTATGATCTTGAACTGACATCTGTGAGGGACAACATAGAATTGAGAAGGCTCTTAGCT
GAAACATTAAGTAAGTCTATTATAGTGATAGAAGACATTGACTGTTCACTTGATCTAACA
GGTCAAAGGAAGAAGAAAGAGAAGACTGCAAAGACCAACAAAGAAGTTCCTCGAAAGGAC
ACACAAGAGAGTGGAAGTAGAATCACTCTCTCTGGGCTTCTGAACTTCATTGACGGTCTT
TGGTCTGCATGCAGTGGAGAGCGTATAATTGTCTTTACTACAAATTATGTGGATAAGTTG
GATCCAGCTCTTACAAGAAGGGGAAGAATGGATAAGCACATCGAGCTCTCCTACTGTAGC
TTTGATGGATTCAAGGTGCTTGCAAAGAATTACCTGAGCTTGGACACACATCCCCTATTT
GAATCAATTGAAATTCTAATGACGGAGACCAAGATTATACCTGCTGATGTTGCAGAGAAC
CTGATGCCCAACTCCCTGAGAGAAGACGCAGAGAAATGCCTTCTGAAGCTGGTTGAAGCT
CTCAAACAGGCAAAACAACTGATGATAAAGAAAGACGAGGAATCCGCACTGTCTGAAGCT
GCAGATGGGTTGCAGGATTCTATAGACAAAATTTAA