Microarray Probes on PGSC0003DMT400035267

Probe IDChipProbe Sequence
CUST_26842_PI426222305 JHI_St_60k_v1 AGAGGATTAGCCTAAGGCAAATCTCTTTTGTATTGAAGAGATAAGCCTAATGAGTGATTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400035267

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400035267 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G20820.1 +3 4e-28 106 71/136 (52%) SAUR-like auxin-responsive protein family | chr5:7046911-7047294 REVERSE LENGTH=127

Transcript Sequence (747 bp)

>PGSC0003DMT400035267 747 pgsc_dm_v3.4
CCTCACTCTTCAAAACACCAAAATTCCTCATTTCTCCTTACACAACAACAACAATGGCTA
AAGGAGGAAAACTCACAAAACTCAAATCCGTGTTGAAGAAAATGCAATCCTTCAAAATTG
GCCGCGTTAATGGCACCGCTGCCGTAGCAACTCATCATCATTCTTCCTCCGAAGAAGACG
ATTCCTTTTCCGATGAAAATCGCTGCTCCGGTAAGGATTTGTTCCCGGTCTACGTCGGGA
AATCTCGCCGCCGGTACCTAGTGAGCTCCGACGTCATCGATCACCCGCTATTTCGCGAAC
TTGTGGAAAGGTCCGGCGAGTCTGAAGAATATATTACAGTTGGATGTGAAGTTGTGCTGT
TTGAACATTTGCTATGGATGCTTGAAAATGCAGATCCTCAGCCGGAGTCATTAGAGGAAT
TGGTTGAATTTTACTCTTGCTGATGTGGAATAACTGTCAGTAACTGAATGGTAAAAATAA
CTGTGACGTGGACGTCGAAATTGGAAATGGCTAATATTTGGTATATAGTTGTAAATTTAA
TTTTCCCAAGAGTTAATGATTTTGATTAATTAGTGGTTTAGAAGGAGCGGGGAAAAAAAT
AAATTAAAAAAGAGGATTAGCCTAAGGCAAATCTCTTTTGTATTGAAGAGATAAGCCTAA
TGAGTGATTTGTTATTTCTTAATCAATGCATGTTCCATTCTTTCCAAATATGTTCCAAGT
TTTTGTTGATCTTATCCATTTTGTTCC