Microarray Probes on PGSC0003DMT400035263

Probe IDChipProbe Sequence
CUST_26827_PI426222305 JHI_St_60k_v1 CCCTTCTGTAGTCATGAAGAGGATTGCAAATTTGACATTATGTAGTGTTACTGTGAATAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400035263

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400035263 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G43190.1 +3 0.0 1219 595/721 (83%) sucrose synthase 4 | chr3:15179204-15182577 REVERSE LENGTH=808

Transcript Sequence (2534 bp)

>PGSC0003DMT400035263 2534 pgsc_dm_v3.4
TTGAAATATTTATGTGTTATTCGTCATACTAGGAAGCAATTGTTTTACCCCCATGGGTTG
CACTTGCTATTCGTCTGAGGCCCGGTGTGTGGGAATATGTCCGTGTGAATGTTAATGCTC
TTATTGTTGAGGAGCTGACTGTGCCTGAGTTTTTGCAATTCAAGGAAGAACTTGTTAACG
GAACTTCCAACGATAACTTTGTTCTTGAATTGGATTTTGAGCCCTTCACTGCATCATTTC
CCAAACCAACCCTCACCAAATCAATTGGAAATGGAGTTGAATTCCTCAACAGGCACCTCT
CTGCTAAAATGTTCCATGACAAGGAAAGCATGACCCCTCTTCTCGAGTTTCTTCGAGTTC
ACCACTACAAGGGAAAGACAATGATGCTAAATGATAGAATTCAGAATTTGTATACTCTCC
AAAAAGTCCTGAGGAAGGCTGAGGAATACCTCACCACCCTTTCCCCAGAAACGTCATACT
CGGCATTTGAGCACAAGTTCCAAGAAATTGGCTTGGAGAGGGGTTGGGGTGACACCGCAG
AGCGTGTTCTAGAGATGATCTGCATGCTCCTGGATCTCCTCGAGGCTCCTGACTCGTGTA
CTCTTGAGAAGTTCCTTAGTAGAATTCCTATGGTTTTCAATGTAGTTATACTTTCACCTC
ATGGATATTTCGCCCAGGAAAATGTCTTGGGTTACCCCGACACTGGTGGCCAGGTTGTCT
ATATTTTGGATCAAGTTCCTGCCTTGGAGCGTGAGATGCTCAAGCGCATAAAGGAGCAAG
GACTTGATATCAAACCACGTATTCTTATTGTTACTCGGCTTCTGCCTGATGCAGTTGGTA
CCACTTGTGGTCAGCGACTTGAGAAAGTATTTGGAACTGAGCATTCACATATTCTTAGGG
TCCCCTTTAGGACTGAAAAGGGCATTGTTCGCAAATGGATCTCTCGTTTTGAAGTCTGGC
CATACATGGAGACTTTCATTGAGGATGTGGGGAAAGAAATAACCGCAGAACTGCAAGCTA
AGCCCGACCTTATTATTGGAAACTATAGTGAGGGAAACCTCGCTGCCTCCTTGTTGGCTC
ACAAGTTAGGTGTAACACAGTGCACCATTGCTCATGCATTGGAGAAAACCAAATATCCTG
ATTCTGACATTTACTTGAACAAATTTGACGAGAAATATCACTTCTCAGCTCAGTTTACCG
CTGATCTTATAGCAATGAATCACACTGATTTCATCATCACCAGCACCTTCCAGGAGATAG
CAGGAAGCAAGGACACCGTTGGACAGTATGAGAGCCACATGGCCTTCACAATGCCTGGAT
TGTATAGAGTTGTTCATGGCATTGACGTGTTTGATCCCAAATTCAACATTGTGTCACCAG
GAGCTGATGTGAATCTCTATTTCCCATACTCCGAAAAGGAAAAGAGATTGACAACTTTTC
ACCCTGAAATCGAAGACTTGCTGTTTAGCGATGTCGAGAATGAAGAACACCTGTGTGTAT
TGAAGAACAGGAATAAGCCCATCATATTCACCATGGCAAGATTGGACCGAGTGAAGAATT
TAACTGGACTCGTCGAGTGGTATGCTAAGAATCCACGACTAAGGGAGTTGGTTAACCTTG
TTGTGGTTGGTGGAGACCGAAGAAAGGAATCCAAAGACTTGGAAGAGCAGGCAGAGATGA
AGAAGATGTATGAACTTATAAAGACTCACAATTTGAATGGCCAGTTCCGATGGATTTCTT
CCCAGATGAACCGCGTGAGGAATGGGGAACTCTACAGGTACATTGCTGACACCAGGGGAG
CTTTCGTGCAACCTGCATTCTACGAGGCTTTTGGTCTGACTGTTGTTGAGGCCATGAGCT
GCGGTTTGCCTACATTTGCAACAAATCAAGGTGGTCCAGCTGAGATCATCGTTCACGGGA
AGTCTGGTTTCCAAATTGATCCATACCATGGCGAGCAGGCTGCTGATCTTCTGGCTGATT
TCTTTGAGAAATGTAAGGTAGACCCTTCACATTGGGAAGCCATTTCTGAGGGTGGCCTTA
AGCGTATACAAGAGAAGTACACATGGCAAATCTACTCCGATCGGCTGTTGACACTAGCTG
CTGTTTACGGGTTCTGGAAGCACGTTTCCAAGCTCGATCGTCTTGAAATTCGTCGTTATC
TTGAGATGTTTTATGCTCTCAAATTCCGCAAGCTGGTAAGTCTCTCTGCTTTCTGCACTT
TTCCAATTGTCTAAAGCAACTACTAATGGAACTTCTCTATTTTGTTTTGATTCAGGCTCA
ACTTGTTCCATTGGCTGTTGAGTAAATTGACAAAGAGGAGAAGGCTTCTGCCTAATTGTT
ATCCATATTGTCCTTTAGAAATTGTTTGTCCTAGTTTGCTTTTCCCCCACATTTGATGTT
TGAGAACTGAATTGTCTTTTTTATTTGCATTTTTTCCCTTCTGTAGTCATGAAGAGGATT
GCAAATTTGACATTATGTAGTGTTACTGTGAATAAAATATCAAATTTCAATCTGCTCTAT
CCATCTTTTTAACC