Microarray Probes on PGSC0003DMT400034927

Probe IDChipProbe Sequence
CUST_31242_PI426222305 JHI_St_60k_v1 ATGGTGATGGTTTGCTCAATTTTGAGGAGTTTGTCATTATGATGCGTTGCTAGTTACATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400034927

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400034927 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G76640.1 +2 7e-24 95 69/135 (51%) Calcium-binding EF-hand family protein | chr1:28765324-28765803 REVERSE LENGTH=159

Transcript Sequence (680 bp)

>PGSC0003DMT400034927 680 pgsc_dm_v3.4
TGGAATACTCTATTTGTTGTTGCAACCTCGTTAAATCCTTGGGTTATTTTTCTTCTCTAC
TTTCTTTGTTTGTGATTGTGCGCTTTCTCAATATATATATATATATATACACATAGTGTG
GTTGATATAATTAAGGATGGAAGGATACAAACGACTTTTTGAGCATATAGATGAGAATGG
AGATGGGAAAATATCAGCATTGGAGTTGCAACAATGTGTGCATTTGATAGGCAAAGACAT
ATTGTTGTTTGAGGAGGCAGAGGCAGCAATTGTGGCCCATGACTCGGACAACGATGGCTT
ATTAGATTTTGACGATTTTATGAGATTAGTGGAAGATGGAGGGACGGAAGAAGAGAAGGA
GCGCGAGTTAAAGGAGGCGTTTAGGATGTATGAGATGGAAGGGTGTGGATGCATAACGCC
GGAGAGTTTAAAGAGAATGCTTCATAAGTTAGGGGAGAAGAGGACTGTTGATGAGTGCAG
AGGAATGATAGCCAGATATGATATCAATGGTGATGGTTTGCTCAATTTTGAGGAGTTTGT
CATTATGATGCGTTGCTAGTTACATATATATATCAATCGTATTTTTTTTTGAGAGTACAA
GCAACATAGTCATTAGTTTGTTTAATTTTGTATTGGTAAATATATAGTACATTCTTTATA
TGGATATTTGATTTGATATA