Microarray Probes on PGSC0003DMT400034831

Probe IDChipProbe Sequence
CUST_31244_PI426222305 JHI_St_60k_v1 TGGCCTTCATTGCTGCATTTGGTGCAATTGCTTTTATGTTGTATTAGTTTGAAGTTAGAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400034831

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400034831 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G22620.1 +2 5e-29 111 81/194 (42%) Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein | chr3:8008615-8009415 FORWARD LENGTH=203

Transcript Sequence (862 bp)

>PGSC0003DMT400034831 862 pgsc_dm_v3.4
TTACAAATTACAAGCATATCATAAAAACAATTTCTCAAAAAGCTTCCTACTATTTACTAT
GGCTTTTCATTACTCTATTTCTTTCCTTTCTTGCATTATTGTTTTAGCAATTTTGCCTAT
TAATGCCCAAATTGTGACATCTCCATGTACAGCAACAATGCTGACAAGTTTCACTCCTTG
CTTGAATTTCTTATCCAACGGCAACGGAACGGCTACACCATCTCCTGGCTGCTGCAATGC
ATTGAGAACAATGATGGGCAATGGCTCTGCTTGTCTCTGTGTTATTGCAAGTGGTGGCAT
TCCCTTTCAGATTCCTATTAATCCTAACACAACCATGTCTCTTCCTCGAGCTTGTAACAT
GGCTCGCGTTCCCCTCCAATGCCAAGCCTCCACTCCACCTGCAGCAGCTCCAGGTCCTGT
TGGAACAGAGGCTCCAAGTGCTTCACCAACATCAGCTCCTACTGCTTCTCCTAGTCCTAA
AGGTACAACAGCTTTCAACCCAATGTCACCAGCTTTGGCACCACAAGCTGATGTAATTCC
TACTGAAACTCCACCATCTCCATCGGCGACGAATTCTGGCCGCCGTCAAAACCCTAATAC
TCCATCAGCTGCCCCTTCTGTTGGCTATGGTTTTTCACCATTGGCCTTCATTGCTGCATT
TGGTGCAATTGCTTTTATGTTGTATTAGTTTGAAGTTAGACAGTACTAAAGTTAGTAAAT
TTGTGTGAGATTTGTACTATTTTGTTATACAACTATTCTTTGATGTAATACAGAATCTTG
AATTTTTTTAATGTATTTCTTGTTGAATTAGTACTAAGGACTCTTTGAATTTTTTAAAAT
TCGAGTGTTTGTTATGTAAAAA